ID: 927395958

View in Genome Browser
Species Human (GRCh38)
Location 2:22651535-22651557
Sequence CAATCTGGACCCTTTGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395958_927395968 24 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG No data
927395958_927395963 1 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395963 2:22651559-22651581 TGGTGAGCCAGGCTGAAGAAAGG No data
927395958_927395965 6 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395965 2:22651564-22651586 AGCCAGGCTGAAGAAAGGCTGGG No data
927395958_927395961 -10 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395961 2:22651548-22651570 GTCCAGATTGATGGTGAGCCAGG No data
927395958_927395966 7 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395966 2:22651565-22651587 GCCAGGCTGAAGAAAGGCTGGGG No data
927395958_927395964 5 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395958_927395969 27 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395958 Original CRISPR CAATCTGGACCCTTTGGACT TGG (reversed) Intergenic
No off target data available for this crispr