ID: 927395960

View in Genome Browser
Species Human (GRCh38)
Location 2:22651541-22651563
Sequence CACCATCAATCTGGACCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395960_927395965 0 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395965 2:22651564-22651586 AGCCAGGCTGAAGAAAGGCTGGG No data
927395960_927395970 28 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395970 2:22651592-22651614 ACAAAGAAGTAGGAGGAGACTGG No data
927395960_927395964 -1 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395960_927395971 29 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395971 2:22651593-22651615 CAAAGAAGTAGGAGGAGACTGGG No data
927395960_927395966 1 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395966 2:22651565-22651587 GCCAGGCTGAAGAAAGGCTGGGG No data
927395960_927395972 30 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395972 2:22651594-22651616 AAAGAAGTAGGAGGAGACTGGGG No data
927395960_927395969 21 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data
927395960_927395968 18 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG No data
927395960_927395963 -5 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395963 2:22651559-22651581 TGGTGAGCCAGGCTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395960 Original CRISPR CACCATCAATCTGGACCCTT TGG (reversed) Intergenic
No off target data available for this crispr