ID: 927395961

View in Genome Browser
Species Human (GRCh38)
Location 2:22651548-22651570
Sequence GTCCAGATTGATGGTGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395955_927395961 6 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395961 2:22651548-22651570 GTCCAGATTGATGGTGAGCCAGG No data
927395958_927395961 -10 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395961 2:22651548-22651570 GTCCAGATTGATGGTGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395961 Original CRISPR GTCCAGATTGATGGTGAGCC AGG Intergenic
No off target data available for this crispr