ID: 927395964

View in Genome Browser
Species Human (GRCh38)
Location 2:22651563-22651585
Sequence GAGCCAGGCTGAAGAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395958_927395964 5 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395962_927395964 -10 Left 927395962 2:22651550-22651572 CCAGATTGATGGTGAGCCAGGCT No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395955_927395964 21 Left 927395955 2:22651519-22651541 CCAAAATATTTTATGTCCAAGTC No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data
927395960_927395964 -1 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395964 2:22651563-22651585 GAGCCAGGCTGAAGAAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395964 Original CRISPR GAGCCAGGCTGAAGAAAGGC TGG Intergenic
No off target data available for this crispr