ID: 927395967

View in Genome Browser
Species Human (GRCh38)
Location 2:22651566-22651588
Sequence GCCCCAGCCTTTCTTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395967_927395969 -4 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data
927395967_927395971 4 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395971 2:22651593-22651615 CAAAGAAGTAGGAGGAGACTGGG No data
927395967_927395972 5 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395972 2:22651594-22651616 AAAGAAGTAGGAGGAGACTGGGG No data
927395967_927395970 3 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395970 2:22651592-22651614 ACAAAGAAGTAGGAGGAGACTGG No data
927395967_927395968 -7 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395967 Original CRISPR GCCCCAGCCTTTCTTCAGCC TGG (reversed) Intergenic
No off target data available for this crispr