ID: 927395969

View in Genome Browser
Species Human (GRCh38)
Location 2:22651585-22651607
Sequence GGGCAGCACAAAGAAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927395967_927395969 -4 Left 927395967 2:22651566-22651588 CCAGGCTGAAGAAAGGCTGGGGC No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data
927395958_927395969 27 Left 927395958 2:22651535-22651557 CCAAGTCCAAAGGGTCCAGATTG No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data
927395962_927395969 12 Left 927395962 2:22651550-22651572 CCAGATTGATGGTGAGCCAGGCT No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data
927395960_927395969 21 Left 927395960 2:22651541-22651563 CCAAAGGGTCCAGATTGATGGTG No data
Right 927395969 2:22651585-22651607 GGGCAGCACAAAGAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927395969 Original CRISPR GGGCAGCACAAAGAAGTAGG AGG Intergenic
No off target data available for this crispr