ID: 927397122

View in Genome Browser
Species Human (GRCh38)
Location 2:22665352-22665374
Sequence CTCGAGAGACAGTTGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927397122_927397130 30 Left 927397122 2:22665352-22665374 CCTACCCCCAACTGTCTCTCGAG No data
Right 927397130 2:22665405-22665427 CCCCCTTCACTTTTCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927397122 Original CRISPR CTCGAGAGACAGTTGGGGGT AGG (reversed) Intergenic
No off target data available for this crispr