ID: 927397122 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:22665352-22665374 |
| Sequence | CTCGAGAGACAGTTGGGGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927397122_927397130 | 30 | Left | 927397122 | 2:22665352-22665374 | CCTACCCCCAACTGTCTCTCGAG | No data | ||
| Right | 927397130 | 2:22665405-22665427 | CCCCCTTCACTTTTCTGCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927397122 | Original CRISPR | CTCGAGAGACAGTTGGGGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||