ID: 927401983 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:22722088-22722110 |
| Sequence | GAGACATTGGAACAGGTTAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 927401983_927401992 | 16 | Left | 927401983 | 2:22722088-22722110 | CCTTTAACCTGTTCCAATGTCTC | No data | ||
| Right | 927401992 | 2:22722127-22722149 | AAAGTCACTTCCACATTTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 927401983 | Original CRISPR | GAGACATTGGAACAGGTTAA AGG (reversed) | Intergenic | ||