ID: 927401983

View in Genome Browser
Species Human (GRCh38)
Location 2:22722088-22722110
Sequence GAGACATTGGAACAGGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927401983_927401992 16 Left 927401983 2:22722088-22722110 CCTTTAACCTGTTCCAATGTCTC No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927401983 Original CRISPR GAGACATTGGAACAGGTTAA AGG (reversed) Intergenic