ID: 927401992

View in Genome Browser
Species Human (GRCh38)
Location 2:22722127-22722149
Sequence AAAGTCACTTCCACATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927401988_927401992 -7 Left 927401988 2:22722111-22722133 CCGGTTACCCAGTTCCAAAGTCA No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data
927401983_927401992 16 Left 927401983 2:22722088-22722110 CCTTTAACCTGTTCCAATGTCTC No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data
927401985_927401992 9 Left 927401985 2:22722095-22722117 CCTGTTCCAATGTCTCCCGGTTA No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data
927401987_927401992 -6 Left 927401987 2:22722110-22722132 CCCGGTTACCCAGTTCCAAAGTC No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data
927401982_927401992 30 Left 927401982 2:22722074-22722096 CCTGTCTTCTGAATCCTTTAACC No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data
927401986_927401992 3 Left 927401986 2:22722101-22722123 CCAATGTCTCCCGGTTACCCAGT No data
Right 927401992 2:22722127-22722149 AAAGTCACTTCCACATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927401992 Original CRISPR AAAGTCACTTCCACATTTTC AGG Intergenic