ID: 927403164

View in Genome Browser
Species Human (GRCh38)
Location 2:22737409-22737431
Sequence TCTCTTCAACAGACAGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927403157_927403164 28 Left 927403157 2:22737358-22737380 CCAACTGATCTTTGAGAGAGGCA No data
Right 927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG No data
927403161_927403164 5 Left 927403161 2:22737381-22737403 CCAAGAATACACACTGGGGAAAG No data
Right 927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927403164 Original CRISPR TCTCTTCAACAGACAGTGTT GGG Intergenic
No off target data available for this crispr