ID: 927405255

View in Genome Browser
Species Human (GRCh38)
Location 2:22758932-22758954
Sequence TGCTGCATTTGACCACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927405255_927405257 1 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405257 2:22758956-22758978 TGAGAGTGTCCTTTATCCATGGG No data
927405255_927405260 15 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405260 2:22758970-22758992 ATCCATGGGTCCATTTTAATGGG No data
927405255_927405256 0 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405256 2:22758955-22758977 GTGAGAGTGTCCTTTATCCATGG No data
927405255_927405259 14 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405259 2:22758969-22758991 TATCCATGGGTCCATTTTAATGG No data
927405255_927405262 21 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405262 2:22758976-22758998 GGGTCCATTTTAATGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927405255 Original CRISPR TGCTGCATTTGACCACATTC TGG (reversed) Intergenic