ID: 927405257

View in Genome Browser
Species Human (GRCh38)
Location 2:22758956-22758978
Sequence TGAGAGTGTCCTTTATCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927405252_927405257 22 Left 927405252 2:22758911-22758933 CCTGGTTTTATTTTGCTAAACCC No data
Right 927405257 2:22758956-22758978 TGAGAGTGTCCTTTATCCATGGG No data
927405251_927405257 23 Left 927405251 2:22758910-22758932 CCCTGGTTTTATTTTGCTAAACC No data
Right 927405257 2:22758956-22758978 TGAGAGTGTCCTTTATCCATGGG No data
927405254_927405257 2 Left 927405254 2:22758931-22758953 CCCAGAATGTGGTCAAATGCAGC No data
Right 927405257 2:22758956-22758978 TGAGAGTGTCCTTTATCCATGGG No data
927405255_927405257 1 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405257 2:22758956-22758978 TGAGAGTGTCCTTTATCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927405257 Original CRISPR TGAGAGTGTCCTTTATCCAT GGG Intergenic
No off target data available for this crispr