ID: 927405259

View in Genome Browser
Species Human (GRCh38)
Location 2:22758969-22758991
Sequence TATCCATGGGTCCATTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927405255_927405259 14 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405259 2:22758969-22758991 TATCCATGGGTCCATTTTAATGG No data
927405254_927405259 15 Left 927405254 2:22758931-22758953 CCCAGAATGTGGTCAAATGCAGC No data
Right 927405259 2:22758969-22758991 TATCCATGGGTCCATTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927405259 Original CRISPR TATCCATGGGTCCATTTTAA TGG Intergenic