ID: 927405262

View in Genome Browser
Species Human (GRCh38)
Location 2:22758976-22758998
Sequence GGGTCCATTTTAATGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927405254_927405262 22 Left 927405254 2:22758931-22758953 CCCAGAATGTGGTCAAATGCAGC No data
Right 927405262 2:22758976-22758998 GGGTCCATTTTAATGGGCCCTGG No data
927405255_927405262 21 Left 927405255 2:22758932-22758954 CCAGAATGTGGTCAAATGCAGCA No data
Right 927405262 2:22758976-22758998 GGGTCCATTTTAATGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927405262 Original CRISPR GGGTCCATTTTAATGGGCCC TGG Intergenic
No off target data available for this crispr