ID: 927409040

View in Genome Browser
Species Human (GRCh38)
Location 2:22804611-22804633
Sequence AATGTCTTTCTCAAGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 36, 1: 95, 2: 138, 3: 205, 4: 400}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409040_927409051 30 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281
927409040_927409050 29 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409050 2:22804663-22804685 GAGAAGATTTACATCTCAAAGGG No data
927409040_927409048 7 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409048 2:22804641-22804663 TGTGAAAGTGGCAAGAGGCTGGG No data
927409040_927409047 6 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG No data
927409040_927409049 28 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data
927409040_927409045 -5 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409045 2:22804629-22804651 ACATTGAAGGGCTGTGAAAGTGG No data
927409040_927409046 2 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409040 Original CRISPR AATGTCTTTCTCAAGGACCT GGG (reversed) Intergenic
902952368 1:19895944-19895966 AATGTCTTCCACAACTACCTAGG - Intronic
903128100 1:21261330-21261352 AAAGTCTTTGTGAAGGAGCTGGG - Intronic
903656532 1:24952197-24952219 AATTATCTTCTCAAGGACCTAGG - Intronic
905176176 1:36136832-36136854 AATGGCTTTCTAAAGGCCCAGGG + Exonic
905223549 1:36465210-36465232 AATGTTTTTCTCAAGGACCTGGG + Intergenic
905505685 1:38477114-38477136 ACTGGATTTCTCCAGGACCTGGG + Intergenic
906025067 1:42666393-42666415 AATGACTTGCTCAAGGTCATAGG - Intronic
906260430 1:44384090-44384112 AATTTATTTCTCAAAGATCTGGG + Intergenic
907815652 1:57916072-57916094 ACTGTCTTTATGAAGCACCTTGG - Intronic
907833626 1:58088766-58088788 AATCTCATCCTCAAGGAGCTTGG + Intronic
909070756 1:70991025-70991047 AATGTGCTTCTCATTGACCTTGG + Intronic
909991926 1:82234100-82234122 CATGTCATTTTCAAGGACATGGG - Intergenic
910271001 1:85394207-85394229 AATGTCTTTCTCATGAGACTAGG + Intronic
910432920 1:87176562-87176584 AATGTCTTTCTCACGACACTAGG + Intergenic
911326593 1:96475571-96475593 AATGTCTTTCTCAAAGGCCCAGG + Intergenic
911369448 1:96979140-96979162 AATGTCTTTATCAATTAGCTTGG - Intergenic
911546041 1:99218093-99218115 AATGTATTTTTCAGGGACCAGGG + Intergenic
911740886 1:101385826-101385848 ATTGCCATTGTCAAGGACCTGGG + Intergenic
911804301 1:102186120-102186142 AATGTTTTTCTCAAGAACCTAGG - Intergenic
911817474 1:102371438-102371460 AATGTCTTTCTCAGGAACCAGGG + Intergenic
911981393 1:104571392-104571414 AACCTATTTATCAAGGACCTAGG - Intergenic
912160780 1:106982243-106982265 TATGTTTTTATCAATGACCTTGG + Intergenic
913324779 1:117617302-117617324 AAACTTTTTCTCAGGGACCTTGG + Intronic
914338895 1:146741411-146741433 AGTGTCTTTCTCAAGGACCTGGG - Intergenic
915312916 1:155013465-155013487 ACTGTCTTGCTGAATGACCTTGG - Intronic
915696759 1:157751278-157751300 AATGTCTATCTCTAAGACTTGGG - Intronic
916426381 1:164685070-164685092 AATGACTTCCTCAAGGACACAGG + Intronic
917374030 1:174328916-174328938 ACTGTCTACCTCAAGGAACTAGG + Intronic
917758005 1:178122646-178122668 AAAATCTTTATCAAGGAGCTTGG + Intronic
918425350 1:184404352-184404374 AATTTATTTCTCAAGGTTCTGGG + Intronic
918686223 1:187418974-187418996 AATATCTTTCTCAGGGAATTGGG - Intergenic
918885879 1:190193794-190193816 AACGTTTTTCTCAAGGGCCAGGG + Intronic
918953403 1:191171882-191171904 AGTATCTTTCTCAAATACCTGGG - Intergenic
919012052 1:191977254-191977276 AATGTGTTTCTCAACGACCTGGG + Intergenic
919021499 1:192111383-192111405 AAAGTAATTCACAAGGACCTGGG + Intergenic
919041218 1:192390864-192390886 AATGTCTTTCTCAAGGACCTGGG + Intergenic
919181774 1:194093870-194093892 CATGGCTATCTCAAAGACCTAGG + Intergenic
919263151 1:195224421-195224443 ACAGTCTTTCTCAAGGACTTCGG + Intergenic
919384398 1:196900922-196900944 AATGTCTTTAACAAAGACCTGGG - Intronic
919522940 1:198611711-198611733 GCTGTCCTTCTCAAGAACCTAGG - Intergenic
919921156 1:202167315-202167337 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
920537894 1:206752114-206752136 AATGTCTTTCTCAAGTACCCGGG - Intergenic
921073502 1:211681950-211681972 AATGTGTTTCTAAGGGACTTAGG + Intergenic
921395161 1:214661504-214661526 AAGGTCTTGCTAAATGACCTAGG - Intronic
921893035 1:220371614-220371636 AATTTCTTACCCAAGGACCCAGG - Intergenic
922275650 1:224075461-224075483 AATATCGTTCTCAAGGAGGTGGG - Intergenic
923089568 1:230729509-230729531 CATGTGTTTCTCAAGGACCCGGG + Intergenic
923318974 1:232810949-232810971 AATGTCTTTCTCTAGGCCCAAGG - Intergenic
923524253 1:234760067-234760089 ACCGTCTTTCTCCAGGGCCTGGG - Intergenic
923881625 1:238110260-238110282 AATATCTTTTTCAAAGACCTGGG + Intergenic
924954586 1:248914370-248914392 AAAGCCCTTCTCATGGACCTTGG - Intronic
1063132267 10:3188637-3188659 AATGTATTTCTCAAGTTCTTGGG + Intergenic
1063179520 10:3585146-3585168 ATTGTCTTTCTAAATGACCCCGG - Intergenic
1064203241 10:13301483-13301505 AATTTCTTTTTCAGGGACCTCGG + Intronic
1064512773 10:16113366-16113388 AATATCTTTCTCAAGGACCTAGG - Intergenic
1065330807 10:24596813-24596835 AATGTCTTTCTCATGATACTTGG + Exonic
1065480006 10:26183563-26183585 AAAGTCGTTTTCAAGGATCTGGG + Intronic
1065876424 10:30001122-30001144 AATGTCTCTCTCAGGGACAAAGG - Intergenic
1066174629 10:32891025-32891047 AATGTCTTTTTCAAGAGCCAAGG + Intergenic
1066685563 10:37978151-37978173 AAGGTCTTTCTTAATGGCCTTGG - Intergenic
1067410385 10:46059458-46059480 AATGTCTTTCCCAAGGACCTGGG - Intergenic
1068047863 10:51910406-51910428 AATGTCCTTCTCAAGGACCTTGG - Intronic
1068129719 10:52882545-52882567 ATAGTCTTTCTCAAGGACCTAGG + Intergenic
1068144464 10:53049464-53049486 AATGTCTCAATCAAAGACCTGGG - Intergenic
1068264107 10:54625256-54625278 AATGTCTTTCTCAAGGACCTGGG - Intronic
1068774032 10:60852316-60852338 AGTGTCTTCCTCAAGTAACTTGG - Intergenic
1068824415 10:61418377-61418399 AATATCTTTCTCAAGGACCTGGG - Intronic
1069106851 10:64393893-64393915 AATGTCTTTCTCAAGGATCTAGG - Intergenic
1069124157 10:64608168-64608190 ACTGTATTTCTTAAGCACCTAGG + Intergenic
1069135872 10:64764988-64765010 AATGTCTTCCTCGAGCACCTGGG + Intergenic
1069176394 10:65294398-65294420 AATGTCTTTCCCAAGTATCTGGG + Intergenic
1069221734 10:65892000-65892022 AATGCCTATCTCAAGGGCCTGGG + Intergenic
1069344066 10:67446682-67446704 AATGTCTTTCTCAAAAACCTTGG + Intronic
1070693729 10:78546433-78546455 AACGTCTTTCCCAGGGACCAGGG + Intergenic
1071732089 10:88258280-88258302 CATATATTTCTCAAGGACTTTGG + Intergenic
1073672539 10:105608190-105608212 TATGTCTTTCTTAAGGACCCAGG + Intergenic
1073711182 10:106044462-106044484 AATATCTTTCCCAAGAATCTGGG + Intergenic
1073759582 10:106615210-106615232 AATGTCTTTCTCAAGGACCTGGG + Intronic
1073819709 10:107247477-107247499 AAAGTCTTTGTTAAGGACCTGGG - Intergenic
1073889398 10:108081570-108081592 GATGTCTTTCTCAAAGACCTGGG + Intergenic
1074481583 10:113826602-113826624 AATGTGTTTCTCAAGGTCTAAGG + Intergenic
1074825783 10:117215040-117215062 AATGTATTTCTCATGGTTCTGGG + Intergenic
1075093082 10:119454227-119454249 AATTTCTTTTTCTAGGACCCAGG - Intronic
1077179594 11:1206399-1206421 AATGTCTTTCTCCAGCGCCCAGG - Intergenic
1077293692 11:1813868-1813890 AATGTCTTTCTCTGTGGCCTGGG - Intergenic
1077444206 11:2582777-2582799 AATGTCATTCTGCAGGACGTAGG - Intronic
1077588555 11:3473632-3473654 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1079690963 11:23416375-23416397 AATGTCTTTTTCAATTACCTGGG - Intergenic
1079711719 11:23692416-23692438 AATGTCTTTTTCAAAGACCTGGG + Intergenic
1079783491 11:24640122-24640144 GTTGTTTTTCTCAAGGACTTGGG - Intronic
1081115078 11:39190955-39190977 AATGTCTTTCTCAGGGAGTTAGG - Intergenic
1081322303 11:41706019-41706041 ATTATCTTTCTCAAGGACCTGGG - Intergenic
1081347964 11:42013612-42013634 CATGTATTTTTTAAGGACCTAGG + Intergenic
1081410051 11:42747136-42747158 AATGTCTTTCTCAAGGCCCCAGG - Intergenic
1081845202 11:46236396-46236418 AATGTCCTTCAGAAGGACATTGG + Intergenic
1082181555 11:49126336-49126358 AATGTCCTTCACAGGGACATGGG + Intergenic
1083023303 11:59529052-59529074 AATGTCTTTCTTAAGGACCTGGG - Intergenic
1083070900 11:59980063-59980085 ACTGTCTTTCTCAATGACCTGGG - Intergenic
1083347130 11:62001444-62001466 AGGGTCTTTCTAAAGGCCCTGGG - Intergenic
1083362415 11:62119989-62120011 AATGTCTTTCTCAAAAACATGGG - Intergenic
1084266852 11:68009494-68009516 AATGTCTTTTTCAGGGAGCTCGG - Intronic
1084828431 11:71749302-71749324 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1085248950 11:75128969-75128991 AATTTCTTTTTCAAGGAGCTCGG - Intronic
1085842454 11:80028350-80028372 AATGTCTTTGTCAAAGTTCTGGG + Intergenic
1086583221 11:88423265-88423287 AGTGACTTGCTCAAGGACATGGG + Intergenic
1086683940 11:89708509-89708531 AATGTCCTTCACAGGGACATGGG - Intergenic
1087323799 11:96696906-96696928 AATGTATTTCTCAAGGACCTGGG - Intergenic
1087415816 11:97854145-97854167 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1087415961 11:97855782-97855804 AATTTCTTTCTCAAGAACCTGGG - Intergenic
1087534185 11:99423397-99423419 AATGTCTTTCTCAACGACCAAGG - Intronic
1087702759 11:101454189-101454211 AATATATTTTTCAAGTACCTGGG + Intronic
1088117774 11:106332352-106332374 AAAGTCTTACTCAAGTACTTGGG + Intergenic
1088669022 11:112123018-112123040 AATGTCTTTCTCAAGGACCCAGG + Intronic
1088915603 11:114225586-114225608 AATGTCGTTCTCAAGGGAGTGGG - Intronic
1090098571 11:123769337-123769359 AATGTCTTTCTCAAGGACCTAGG + Intergenic
1090331354 11:125934778-125934800 AATGTCTTCCTCCAGCACATAGG + Intergenic
1090661472 11:128885217-128885239 AATGCCTCTCTCAGGCACCTGGG + Intergenic
1091960737 12:4692007-4692029 ACTGTCTTTCTCAAGGACCCAGG - Exonic
1092414821 12:8282402-8282424 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1092562888 12:9635114-9635136 AATATCTTTCTCAAAGACCTGGG + Intergenic
1092572975 12:9745440-9745462 AATGTCTTTCTCAAAGACCTGGG - Intergenic
1092581850 12:9850493-9850515 AATGTCTTCCTAAAGGACCTGGG + Intergenic
1093133394 12:15419429-15419451 AATTTTTTTCCCAAGAACCTTGG - Intronic
1093619598 12:21273285-21273307 AGTGTCTCTCTCAAGGACAGAGG - Intronic
1094005865 12:25750498-25750520 AATGACTTTCCCAAGTAGCTGGG + Intergenic
1094616414 12:32040290-32040312 AAAGTCTTTCTCCAAGACCTGGG + Intergenic
1094772720 12:33684177-33684199 AATGCCTCTTTGAAGGACCTGGG + Intergenic
1095124351 12:38458571-38458593 AATGTCTTTCTTAAGGACAGAGG + Intergenic
1095156199 12:38858068-38858090 AATGCCTTTCTCAAGAACATAGG + Intronic
1095281461 12:40355878-40355900 AATGTCTTTTCCAAGGACCTGGG - Intronic
1095313204 12:40725539-40725561 AATGTCTTTCTCAAGGACCTGGG + Intronic
1095365231 12:41395411-41395433 AATGATTTTTTCATGGACCTTGG + Intronic
1095411923 12:41933774-41933796 AATGCCTTTCTCAAGGACCTGGG + Intergenic
1095481529 12:42641204-42641226 AATGGCTTTCTCAAGGCCCTTGG + Intergenic
1095590824 12:43901833-43901855 AATGTTTTTTTCAAGAGCCTGGG + Intronic
1095922614 12:47545832-47545854 AATCTCTTTTTGCAGGACCTCGG - Intergenic
1096031556 12:48420515-48420537 ATAATCTTTCTTAAGGACCTGGG + Intergenic
1096918173 12:55055901-55055923 AATGTCTTGCTCAGGGGCCTGGG - Intergenic
1097334983 12:58372022-58372044 AACATCTTTCTCAAAGACCTGGG - Intergenic
1097471162 12:59993870-59993892 AAGATCTGTCTCAAGGACCTGGG - Intergenic
1097494358 12:60312051-60312073 GATGTCTTTCTCAAGGACCTGGG - Intergenic
1097590240 12:61565669-61565691 AATGTCTTTCTCATGGATCTTGG + Intergenic
1097591463 12:61580791-61580813 AATGTTTCTCTCAAAAACCTGGG + Intergenic
1097597118 12:61647657-61647679 GATGTCTTTCTCAAGGACCTAGG + Intergenic
1097608080 12:61780554-61780576 AATATCTTTCTCAAGGGCCCTGG + Intronic
1097639445 12:62162116-62162138 AATGTCTTTCTCAAGGACCCAGG + Intronic
1098633076 12:72748394-72748416 ACCCTCTTTCTCAAGGACCTGGG - Intergenic
1098640516 12:72833358-72833380 AATGTCTTTCTTAAGTACTTGGG + Intergenic
1098658305 12:73060615-73060637 AATGTCTTTCTCAAGGATCTGGG + Intergenic
1098688608 12:73457813-73457835 AATGTCTCTCTTAAGGACCTGGG - Intergenic
1098710131 12:73747537-73747559 AATGTCTTTCTCAGGGATCTGGG + Intergenic
1098775129 12:74603208-74603230 AATGTCTTTCTCAAAAACCTGGG - Intergenic
1098781406 12:74691272-74691294 AATGTTTTTCCTAAGAACCTGGG - Intergenic
1098806565 12:75026970-75026992 AATGTCTTTCTCAGGGATCTGGG - Intergenic
1099084866 12:78233058-78233080 CATGGCTTTCTCTAAGACCTGGG - Intergenic
1099138315 12:78936993-78937015 AATGTCTTTCTCAAGGACCTGGG - Intronic
1099375066 12:81889047-81889069 AATGTCTCTCCCAAGTACCTTGG + Intergenic
1099567448 12:84270639-84270661 AATGTCTTTCGCACGCACCTGGG - Intergenic
1099599337 12:84712693-84712715 AATGTCTTTCTCAATGACCTGGG + Intergenic
1099709794 12:86208557-86208579 AATGTCTTTACCAAGAACCTGGG + Intronic
1099760735 12:86917317-86917339 AATGTCTTTCTTAAGGACCTGGG - Intergenic
1099800015 12:87444903-87444925 AATGTTCTTCTCAAGAAACTGGG - Intergenic
1099831306 12:87846250-87846272 AATGTCTTTCTCAAGGACCTAGG - Intergenic
1103052771 12:117795524-117795546 AATGTCATTCTCTGGGAGCTGGG - Intronic
1104128092 12:125866365-125866387 AATGTGTTTCTCAAGGACATGGG - Intergenic
1104161673 12:126187016-126187038 AATATCTTTCTCAAGGACCTGGG + Intergenic
1104340571 12:127944990-127945012 CCTGTCTTTCTCAAGGACCTGGG + Intergenic
1104640806 12:130465687-130465709 ACTGTATTTCTCAAGAGCCTGGG + Intronic
1105249350 13:18683602-18683624 CATTTCTTTCTCAAGGTCGTGGG + Intergenic
1106048709 13:26169627-26169649 AATGTCTTTCTGAAGGAACTAGG + Intronic
1107163512 13:37259275-37259297 AATGTCTTTCTTACGAACCTGGG + Intergenic
1107421851 13:40254628-40254650 AATGCCTTTCTCAAGGACCTGGG - Intergenic
1107491173 13:40880926-40880948 AATTTCTCTCTCAGGGAGCTTGG - Intergenic
1108151484 13:47540330-47540352 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1108345768 13:49545762-49545784 AGTGTCTTAATCAAAGACCTCGG + Intronic
1108357112 13:49638057-49638079 AATATCTTTTTCAAGGACCAAGG + Intergenic
1108541227 13:51448436-51448458 AATGTTTTCCTCAAGCACTTTGG - Intronic
1108823850 13:54387794-54387816 AATCTCTTTCTTAAGGACCTGGG - Intergenic
1108834247 13:54521039-54521061 AATGTCTTTCTCAAGAACCAGGG - Intergenic
1108839864 13:54599582-54599604 AATGTTTTTCTCAAGGACTCGGG - Intergenic
1108872294 13:55002226-55002248 AATGCCTTTCTGAAGGACCTGGG - Intergenic
1108913843 13:55584450-55584472 AATGTCTTTATCAAGGACCGTGG - Intergenic
1108926171 13:55748690-55748712 AATGTCTTTCTCTAGGGCCGGGG + Intergenic
1109154129 13:58883595-58883617 AATGTCTGTGTCAAGGACCTGGG - Intergenic
1109334366 13:60974338-60974360 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1109348627 13:61146580-61146602 AATGTCTTTCTCAAGGTCCTGGG - Intergenic
1109387522 13:61651739-61651761 AAAGTCTTTTTCAAGAACCTGGG + Intergenic
1109516488 13:63449782-63449804 AATGTCTTTCCCAAGGACCTGGG + Intergenic
1109555336 13:63967070-63967092 AATGTCTTTCTCAGGAACCTTGG - Intergenic
1109662636 13:65484430-65484452 AATGTCCTTTTCAGGGACATGGG - Intergenic
1109669297 13:65584299-65584321 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1109703685 13:66060440-66060462 AATTTCTTTCTCAAGGATCTGGG - Intergenic
1109727980 13:66370196-66370218 AATGTCTTCCTCAAGGACCTAGG + Intronic
1109737783 13:66509297-66509319 AATGTCTTTTTCAAGAACCTGGG + Intronic
1109743927 13:66595136-66595158 GATGTCTTTCTCAAGAACCTGGG + Intronic
1109800540 13:67371668-67371690 GATGTCTTTCTCAAAGACCTGGG - Intergenic
1109848010 13:68022661-68022683 AATGTCTTTCTCAAGAACCTGGG - Intergenic
1109862677 13:68221306-68221328 AATGTTTTTCTCAATGACCTAGG + Intergenic
1109897608 13:68713552-68713574 AATGTCTTTCTCCAGGACCTGGG + Intergenic
1109969111 13:69741787-69741809 ACTATCTTTCTCAAGGACTCGGG + Intronic
1110025647 13:70535521-70535543 AATATCTTTCTCAAGGAGGTGGG + Intergenic
1110254945 13:73423099-73423121 AAGGTCTTTGTCAAAGCCCTGGG - Intergenic
1110493220 13:76134077-76134099 AATGCCTTTCTCAAGGACCAGGG - Intergenic
1110509919 13:76337402-76337424 AATGTCTTTCTCAAGGACCTGGG - Intergenic
1110718542 13:78735330-78735352 AATGTCTTTCTCATGGACCTGGG + Intergenic
1110856609 13:80303694-80303716 GATGTCTCTTGCAAGGACCTTGG - Intergenic
1110954633 13:81538858-81538880 AATCTCTTTCTCAAGGATCTGGG + Intergenic
1111030963 13:82597979-82598001 AATGTCTTTCTCAAAGACCCAGG - Intergenic
1111044947 13:82802798-82802820 ACTGTTTTTCTCAAAGGCCTAGG - Intergenic
1111052661 13:82905507-82905529 GATGTTTTTCTCAAAGACCAGGG - Intergenic
1111059977 13:83004324-83004346 GATGTCTTTCTCAAGGACCTGGG + Intergenic
1111190560 13:84801246-84801268 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1111307312 13:86432266-86432288 AATGTGTTTTTCAAGAACCTAGG - Intergenic
1111315953 13:86559996-86560018 AATGTCTTTCTTAAGGACCTGGG + Intergenic
1111333399 13:86791077-86791099 AATGTGTTTCTCAAGGACCTGGG + Intergenic
1111376982 13:87393155-87393177 AATTACTTTCTCAAGGACCCGGG + Intergenic
1111383966 13:87498859-87498881 GATGTCTTTCTCCAGGACCATGG + Intergenic
1111425804 13:88080059-88080081 AATGTATTTCTCACAGTCCTGGG - Intergenic
1111435949 13:88208321-88208343 ACTGTCTTTCTCAAAGATCTGGG - Intergenic
1111454408 13:88461532-88461554 GAATTCTTTCTCAAGGACTTGGG - Intergenic
1111533597 13:89572881-89572903 ACTGTCTTTCTTAAGGACCTGGG - Intergenic
1111534567 13:89586168-89586190 AATGTTTTTCTCAAGGACGTGGG + Intergenic
1111554160 13:89858047-89858069 CTAGTCTTTCTCAAGGACCTAGG + Intergenic
1111562491 13:89969290-89969312 GATGTTTTTCTCAAGGACCTGGG - Intergenic
1111571092 13:90087285-90087307 ATTGTCTTTCTCAAAGTACTAGG - Intergenic
1111610260 13:90596368-90596390 AATGTCTTTTTCAAAGAGTTAGG - Intergenic
1111884450 13:94002084-94002106 AATATCCTTCTCAAGGAACTGGG - Intronic
1111897131 13:94155759-94155781 AATGTCTATGTCAAGGACTTTGG - Intronic
1112437118 13:99398511-99398533 ACTGTCCTCCTCAAGGACCCAGG + Intergenic
1112829405 13:103429960-103429982 AATGTCTTTTTCAAGGACCTGGG - Intergenic
1112902120 13:104369799-104369821 GATGTCTTTTGCAAGGACCTGGG + Intergenic
1113224462 13:108144255-108144277 GCTGTCTTTTTCAAGGACCTGGG + Intergenic
1113241292 13:108340530-108340552 AGTGTCTTTCTCAAAGACCTAGG + Intergenic
1113245457 13:108389961-108389983 AATGTCTTTCTCAAAGACCTAGG - Intergenic
1113297410 13:108974798-108974820 AGAGTATTTCTCAAGGATCTTGG + Intronic
1113396859 13:109955965-109955987 AACATCTTTCTCAAAGACTTCGG + Intergenic
1113452403 13:110420490-110420512 AATATTTTTCTCAAGGATGTTGG + Intronic
1114426453 14:22627930-22627952 AATGTCTTTCTTAAGGACCTGGG + Intergenic
1114591534 14:23869419-23869441 AATGGCCTTCTCAAGGACCTTGG - Intergenic
1114823536 14:26050580-26050602 AATGTCATTCTCAAGTTTCTGGG + Intergenic
1114935365 14:27529807-27529829 AATATCTTTCTTATGGACTTAGG - Intergenic
1116298252 14:43140777-43140799 CAGGACTTTCTCAAGGACCCAGG - Intergenic
1116402489 14:44525218-44525240 GACTGCTTTCTCAAGGACCTGGG + Intergenic
1116424117 14:44768579-44768601 AATATTTTTCTCAAGGACCTAGG - Intergenic
1116545023 14:46154571-46154593 AATGTCTTTTTGAAGGACTTGGG + Intergenic
1116561629 14:46386753-46386775 ACTGTCTTTCTCAAGGAACTTGG - Intergenic
1116572899 14:46540444-46540466 AATGTCCTTCTTAAGGATCTGGG - Intergenic
1116610876 14:47070391-47070413 AATGTCTTTCTCAAGTATGTGGG + Intronic
1116635557 14:47390300-47390322 AATGTCTTTCTCAAAGACTAGGG + Intronic
1116688354 14:48072465-48072487 AATGTCTTTTTCAAGGATCTGGG - Intergenic
1116742841 14:48778232-48778254 AATGTTTTTCTCAAATAACTGGG + Intergenic
1117003636 14:51396201-51396223 AATGTATTTCTCAAGTATATGGG - Intergenic
1117270417 14:54137670-54137692 AATGTCTTTTTGAAGAATCTTGG - Intergenic
1117387521 14:55230947-55230969 AATATTTATCTCAAGAACCTGGG + Intergenic
1120078540 14:80187855-80187877 AATATTTTTCTCAAGGTCCTTGG + Intergenic
1120215945 14:81680792-81680814 AATGTTTTTCTCAAGGATCTGGG + Intergenic
1120409713 14:84137807-84137829 AATGTCTTTCTAAAAGATCTGGG + Intergenic
1120652355 14:87150127-87150149 TATGTATTTCTCAAGGACCCGGG + Intergenic
1120704379 14:87732185-87732207 TATGTCTTTCTCTAGGCCCGAGG - Intergenic
1121871369 14:97410965-97410987 AAGGTCATTGTCAAGGACTTGGG + Intergenic
1122443784 14:101754287-101754309 AATTTCTTTTTCCAGGAGCTCGG + Intergenic
1124558621 15:30750089-30750111 ACTGTCTTTCTCCATCACCTTGG + Intronic
1124672630 15:31655541-31655563 ACTGTCTTTCTCCATCACCTTGG - Intronic
1125312003 15:38389885-38389907 AATGCCCTTCTCAAAGTCCTTGG - Intergenic
1125511324 15:40293975-40293997 AATGCCTTCCCCCAGGACCTGGG + Intronic
1126217345 15:46171530-46171552 AATGGCTTTCTCAAGAACCAGGG - Intergenic
1126685689 15:51246901-51246923 AATGCATTTCTCCAGGAGCTGGG - Intronic
1126987357 15:54327874-54327896 AATGCCTTTCTGAAAGACTTGGG - Intronic
1127038251 15:54943913-54943935 AATTTCTTTCCCAAGGACCTGGG - Intergenic
1127685036 15:61335143-61335165 AATGTCTTTTTCAAGAACTTCGG + Intergenic
1128691162 15:69725975-69725997 AACTTCTTTCTCAAGGCCCTGGG - Intergenic
1129165890 15:73777216-73777238 AAGGACTTGCTCAAGGCCCTGGG + Intergenic
1129610254 15:77048206-77048228 AATGTATTTCTCTAGGAATTAGG - Intronic
1130854660 15:87830720-87830742 AATCTCCTTCACACGGACCTTGG + Intergenic
1131208247 15:90470380-90470402 AATGTCTGTCTGAATCACCTGGG + Intronic
1131298016 15:91169290-91169312 AATGTCTTCTTTAAGAACCTGGG + Intronic
1131486167 15:92822548-92822570 AATGTCTTACTCAGTGACCTGGG - Intergenic
1133010440 16:2907709-2907731 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1133474652 16:6108692-6108714 TATCTCCTTCTCAAGGTCCTGGG + Intronic
1133847898 16:9474119-9474141 AATGGCTTTCTCAGGGACCTGGG - Intergenic
1135298431 16:21302773-21302795 ATCATCTTTGTCAAGGACCTGGG - Intronic
1136177191 16:28525355-28525377 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1136177265 16:28525956-28525978 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1136651794 16:31679282-31679304 ACTATCTTTCTCAAGGGCCTGGG - Intergenic
1136671421 16:31862033-31862055 ACTGTCTTTCTCAAGGGCCTGGG - Intergenic
1136673584 16:31879069-31879091 ACTGCCTTTCTCTAGGAACTGGG + Intronic
1136677138 16:31920965-31920987 AATACTTTTCTCCAGGACCTGGG + Intergenic
1137542480 16:49374377-49374399 AATGTTTTTCTCAAGGACCTGGG - Intronic
1138231743 16:55342630-55342652 TATGTCTTGCTCATGGAACTTGG - Intergenic
1138737651 16:59269395-59269417 GATGTCTTTCTCAAGGATGTGGG + Intergenic
1138743821 16:59340089-59340111 AAAGTCTTTCTCAACAACCTGGG - Intergenic
1138953495 16:61942690-61942712 AATGTCTTTAACAAGGAACAAGG - Intronic
1139111325 16:63894607-63894629 AATGTCTTTCTCAAGAATCTGGG + Intergenic
1139995386 16:70975941-70975963 AGTGTCTTTCTCAAGGACCTGGG + Intronic
1140548509 16:75836507-75836529 ATTGTTTTTCTTAAGGACCTGGG + Intergenic
1140580248 16:76223077-76223099 AATGTCTTTCTCAAGGACCTGGG - Intergenic
1140590451 16:76345708-76345730 GATATCTTTCTCAAGGACCTGGG - Intronic
1140742256 16:77952135-77952157 AATGTCTTTCTCAAGGACTTGGG - Intronic
1140771987 16:78213757-78213779 AATGTCTTACCCAGGGAACTAGG + Intronic
1143443441 17:6993345-6993367 GATGTCTTTCACAAAGACCCAGG + Intronic
1144182748 17:12768177-12768199 ATTGTCTTGTTCCAGGACCTGGG - Exonic
1144250289 17:13409468-13409490 AATGTCTTTCTTAAGAACCTAGG + Intergenic
1145324632 17:21793643-21793665 AATGTATTTCTCAAACTCCTAGG - Intergenic
1145405201 17:22584172-22584194 AATGTCTTCCTAAAGAATCTGGG + Intergenic
1147471796 17:40669210-40669232 GATGTATTTCTCAAGTACCTGGG - Intergenic
1147504612 17:41003345-41003367 TTTGTCTTTTTCAAGCACCTAGG + Intergenic
1147760808 17:42796376-42796398 ACTGTTTTTCTCCAGGCCCTGGG + Intronic
1149089181 17:52757918-52757940 AATGTGTTTCTCAAGGATTTGGG - Intergenic
1149134220 17:53345411-53345433 AATGTCTTTCTCAAGGAAATAGG - Intergenic
1149224990 17:54459513-54459535 AATGTCTTTTTCAAAAACCTGGG + Intergenic
1150683993 17:67305493-67305515 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1151028405 17:70706169-70706191 AATGTCTTTCTCAAAGACATGGG - Intergenic
1151547524 17:74802194-74802216 AATGTCACTCTCAGGGACGTGGG + Intronic
1152126230 17:78448876-78448898 AATTTATTTCTCATGGTCCTGGG - Intronic
1152222457 17:79076056-79076078 AATGTCATTCTGGAGGCCCTGGG + Intronic
1154409363 18:14128658-14128680 ATTGTCTTAATCTAGGACCTGGG - Intronic
1154439539 18:14375618-14375640 CATTTCTTTCTCAAGGTCATGGG - Intergenic
1155697428 18:28699134-28699156 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1155733268 18:29188790-29188812 AATGTCCTTCTCAAGGACCTGGG + Intergenic
1155812346 18:30252944-30252966 ATTGTCTTTAGCAAGGACCTTGG - Intergenic
1155814442 18:30287460-30287482 GAAATCTTTCTCAAGGACCTGGG + Intergenic
1155861241 18:30902981-30903003 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1155915489 18:31553181-31553203 GATGTCCTTCTGAAGGACCTGGG - Intergenic
1156194480 18:34758651-34758673 AATGTCTTTCTCAAGAACCTGGG - Intronic
1156905222 18:42344550-42344572 AATGTCTTTTTCAAGAACCTGGG + Intergenic
1157124508 18:44943379-44943401 AATGTGTTTCACAAAGTCCTAGG - Intronic
1157438481 18:47691386-47691408 ATTGTCTTACGCAGGGACCTTGG + Intergenic
1157934202 18:51855840-51855862 AATTTCTTTGTCAAGGTCTTGGG - Intergenic
1158152516 18:54388490-54388512 AATGTCATTCTAAAAGAGCTTGG - Intergenic
1158161842 18:54493658-54493680 ACTGTTTTTCTCAAGGACCTGGG + Intergenic
1158246353 18:55436983-55437005 AATGTTTTTCTCAGGGACTTGGG - Intronic
1158796283 18:60849856-60849878 AGTGTCTTTCTCTTGAACCTGGG + Intergenic
1158830693 18:61274640-61274662 ATTGTCTTTCTTAAGGACCTGGG + Intergenic
1158842894 18:61407275-61407297 AATGTCTTTCTCAAGGCCCTGGG - Intronic
1158974635 18:62700418-62700440 AATGTCTTTCTCAAGGACCCAGG - Intergenic
1159070463 18:63617274-63617296 AATATCTTTCTCAAGGACCTGGG - Intergenic
1159116233 18:64115826-64115848 ACTGTCTTTCTCAAGGATCTGGG + Intergenic
1159122118 18:64183229-64183251 AATGTCTTTCTCAAAGACCTGGG - Intergenic
1159130417 18:64275071-64275093 AATATCTTTCTCAAGGACCTGGG - Intergenic
1159176424 18:64841229-64841251 AATATATTTCTCATGTACCTGGG - Intergenic
1159200591 18:65178909-65178931 AATATCTTTCACAAGAACCAGGG + Intergenic
1159213955 18:65365673-65365695 AATGTCTTCCTCAAGGACCCAGG - Intergenic
1159235629 18:65669289-65669311 AATATCTTTCTCAAGGACCTAGG + Intergenic
1159253053 18:65906847-65906869 GATGTCTTTCTCAAGGACCTGGG - Intergenic
1159350890 18:67271046-67271068 AATGTCTTTCTCAAGAGAATAGG - Intergenic
1159377658 18:67614596-67614618 AGTGTCTTCCTCAAAGACCTGGG - Intergenic
1159447519 18:68558748-68558770 AATGTCTTTTTTAAGAACCTGGG + Intergenic
1159470592 18:68850402-68850424 GCAGTCTTTCTCAAGGACATAGG - Intronic
1159502584 18:69293249-69293271 AATATATTTCTCAAGGACCCGGG - Intergenic
1159528571 18:69626790-69626812 AATGTCTTTCTCAAGGACCTGGG - Intronic
1159549960 18:69884545-69884567 AATGTCTTTCTCGAGGACCTGGG + Intronic
1159638809 18:70839318-70839340 AATGTGTTTCTGAAGGGCCTGGG + Intergenic
1159644905 18:70906273-70906295 AAAGTTTTTCTCAAGTATCTGGG - Intergenic
1159677582 18:71305003-71305025 AATGTCTTTCTCAAGTTCCTGGG + Intergenic
1159749800 18:72286118-72286140 AATATTTTTCTCAAGGGCTTGGG + Intergenic
1159762432 18:72444892-72444914 AATGTGTTTCTGAAGGGCCTGGG + Intergenic
1159879558 18:73845624-73845646 AATGTCTTTCTTAGGGAACGGGG - Intergenic
1160181179 18:76638091-76638113 AATGTCTCTGTCAAGGGCCCTGG - Intergenic
1161720728 19:5900961-5900983 AATGTCACTCTCAAAGACCCCGG + Intronic
1165371946 19:35413997-35414019 AATGTTACTCTCAATGACCTTGG + Intergenic
1165818493 19:38658908-38658930 AATGTCTTTTTCAAGAATGTCGG + Intronic
1166215555 19:41332222-41332244 ATTGACTTCCGCAAGGACCTCGG - Exonic
1166572189 19:43804202-43804224 AATGTCTTTTTCAAGGACCTGGG + Intronic
1166766736 19:45255736-45255758 AGTGTCTTTCTCAGAGACTTGGG + Intronic
1167339286 19:48905361-48905383 TCTGTCCTTCTCATGGACCTGGG + Intronic
1167858827 19:52266592-52266614 GATATCTTTCTCAAGGACTTGGG + Intergenic
1167915670 19:52738379-52738401 AATGTATTTCCGAAGGACTTGGG - Intergenic
1167932838 19:52881844-52881866 AATGTCTTTCTCAATTTCCTGGG + Exonic
1167938675 19:52927923-52927945 GATGTATTTCTGAAGGACTTGGG - Intergenic
1167940780 19:52944195-52944217 GATGTATTTCTGAAGGACCTGGG - Intronic
1167987170 19:53328375-53328397 GATGTCTTTCTAAAGAACCTGGG + Intergenic
1167987640 19:53332444-53332466 GATGTATTTCTGAAGGACTTGGG + Intergenic
1167994585 19:53392094-53392116 GATGTATTTCTGAAGGACTTGGG + Intronic
1168003109 19:53464765-53464787 GATGTATTTCTGAAGGACTTGGG + Intergenic
925040738 2:731700-731722 ACTGCTTTTCTCAAGGACCTGGG - Intergenic
925102705 2:1262413-1262435 ACTGTCTTTCTCAAGGAGCTGGG - Intronic
925112336 2:1347057-1347079 AATTCCTTTCTAAAGGGCCTGGG - Intronic
925838972 2:7972972-7972994 ACTGTGTTTCTCATGGACGTGGG - Intergenic
926310425 2:11670757-11670779 AGTGTCATTCTCATGGAGCTAGG + Intergenic
926461536 2:13135845-13135867 AATCTCTTTATCAAGGCCCATGG - Intergenic
926514347 2:13822587-13822609 ACTGCCTTTCTCAAGGACCTAGG - Intergenic
926573459 2:14554820-14554842 AATGTATTTCTTAAGGAGATTGG + Intergenic
926932900 2:18057888-18057910 AATTGCTTAATCAAGGACCTTGG - Intronic
927322673 2:21765908-21765930 AATATCTGTATCAAGTACCTAGG - Intergenic
927409040 2:22804611-22804633 AATGTCTTTCTCAAGGACCTGGG - Intergenic
929524886 2:42692928-42692950 AAAGGCTTTCTAAAGGACTTGGG + Intronic
929544495 2:42846921-42846943 AAGGTTTTTTTCATGGACCTGGG + Intergenic
930275665 2:49308225-49308247 AATGCTTTTCTCAAGAAACTTGG + Intergenic
930351234 2:50257520-50257542 AATGTCTTTCTCAAGGGCCTAGG + Intronic
930398252 2:50849372-50849394 AATGTCTTTCTCAAGGTCCTGGG + Intronic
930430919 2:51275003-51275025 AATGTGTTCCTCAAGGACTTGGG - Intergenic
930434796 2:51327324-51327346 AATATCTTTCTTGAGGACCTGGG + Intergenic
930458076 2:51632143-51632165 AATATCTTTCTCAAGGACCAGGG - Intergenic
930507091 2:52296667-52296689 CATATCTTTCTCAAGAACCTGGG + Intergenic
930538394 2:52672518-52672540 AATGTCTTTCTCAAAGACCAGGG - Intergenic
930578670 2:53183566-53183588 AAGGTCTTTGTCAAGAACCTGGG - Intergenic
930935163 2:56940075-56940097 AATGGCTGTCTGGAGGACCTGGG + Intergenic
932113041 2:69018677-69018699 AGTGACTTGCCCAAGGACCTAGG + Intronic
932667133 2:73707161-73707183 ACTGTGTTCCTGAAGGACCTGGG + Intergenic
932669796 2:73727679-73727701 ACTGTGTTCCTGAAGGACCTGGG + Intergenic
932916992 2:75870320-75870342 AATGGCTTTGTCAAGGACCTGGG - Intergenic
932989836 2:76773112-76773134 AATATCTTTCTCAAGGACCTGGG + Intronic
933029940 2:77315761-77315783 TCTGTCTTTCTCAAGGATCTGGG + Intronic
933137562 2:78757380-78757402 AATGTCTTACTCAAGGACCTGGG - Intergenic
933150775 2:78912172-78912194 AATGACTTTCACAAGAACCTGGG + Intergenic
933283820 2:80362219-80362241 AGTGTCTTTCTCAAGGACCTGGG - Intronic
933470131 2:82711905-82711927 AATGTGTTTCTCAAGGATCTGGG + Intergenic
933738569 2:85515120-85515142 ACTGTCTTCCTCAAAGACTTAGG - Intergenic
934880535 2:97972907-97972929 TATTTCTTTCTGAAGGCCCTAGG - Intronic
935031528 2:99327630-99327652 AATGGCTTTCTAAAGGACATGGG - Exonic
936280107 2:111131630-111131652 AGTGTCTGTCTCAAGAAACTAGG - Intronic
937136405 2:119557479-119557501 AATGTCATTCTAAAGGATATTGG + Intronic
937410357 2:121669685-121669707 ACTGTCTTCCTCAATGGCCTCGG - Intergenic
937585503 2:123543139-123543161 CATGTCTTTTTCAGGGACATGGG + Intergenic
937994627 2:127683797-127683819 AATTTCTTTCTCGGGGAGCTCGG + Intergenic
938153724 2:128909616-128909638 AATGCCTTTCTCAAGTACCTGGG - Intergenic
938517349 2:132026972-132026994 AATGTATTTCTCAAACTCCTAGG - Intergenic
938703463 2:133899511-133899533 ACTGTCCTTATCAAGTACCTTGG - Intergenic
940031889 2:149272320-149272342 TATGCCTTTCTCAAGGTCCATGG + Intergenic
940501114 2:154494674-154494696 AATGTCATCCTCAAGAATCTGGG - Intergenic
941752409 2:169147050-169147072 ACTGTTTATCTCAGGGACCTGGG + Intronic
942596925 2:177600376-177600398 AATGTGTTTGTCAAGGATCTAGG - Intergenic
942736297 2:179117994-179118016 AAGGTCTCACTCAAGCACCTAGG + Intronic
943094159 2:183408699-183408721 AATGTCTTTTTCAAGGATCTTGG - Intergenic
943094266 2:183409855-183409877 AATGTCTTTCTTAAGAATCTGGG + Intergenic
943166799 2:184338930-184338952 AATGTCTTTCTCAAAGACCTGGG + Intergenic
943235828 2:185318379-185318401 AATATATTTCTCTAAGACCTGGG + Intergenic
943355708 2:186852603-186852625 CATGTCTTTCTCAAGGACCTGGG + Intergenic
943897419 2:193382774-193382796 AATGTCTTCCTCCAGGGCTTGGG - Intergenic
944013720 2:195006230-195006252 AAGGTCTTTCTCGGGGAGCTGGG + Intergenic
944683760 2:202099808-202099830 AATGTCTTGCTCATTGATCTGGG + Intronic
944720549 2:202419076-202419098 AATTTCTATCTGAGGGACCTGGG - Intronic
944759265 2:202796381-202796403 AATATCTTTCTCAAGCAATTAGG - Intronic
945324584 2:208467782-208467804 AATGTCTTTCGCAAGGACCTAGG - Intronic
945813761 2:214578599-214578621 AAAGAATTTCTCAATGACCTGGG - Exonic
945904407 2:215575008-215575030 AATGGCTTTCTCAAACACATAGG + Intergenic
945915600 2:215701042-215701064 ACTGACCTTGTCAAGGACCTGGG + Intergenic
946899973 2:224362887-224362909 AATGTCTTTCTCATGAGACTGGG - Intergenic
946981115 2:225216673-225216695 AGTGACTTTCTCAAGGTCATAGG + Intergenic
947243660 2:228022569-228022591 AATGTCTTTCTCAAGGACCTGGG - Intronic
947288706 2:228547086-228547108 ACTGTCTTTCTTAAGCACCTTGG + Intergenic
947291950 2:228585503-228585525 ACTGACTCTCTCAAGGACCTGGG + Intergenic
947847787 2:233259436-233259458 AAAGTTTTTCTCCAGGAACTAGG - Intronic
948016322 2:234693581-234693603 AATTTCTATCTCAAGGGTCTGGG + Intergenic
948071114 2:235126927-235126949 AATGTCTTTCTTAAGGACCTGGG - Intergenic
1168746925 20:251457-251479 AATATCTTTGTCAAATACCTAGG + Intergenic
1169477984 20:5949890-5949912 AAGTTCTTTCCCTAGGACCTTGG - Intronic
1169485537 20:6027910-6027932 AATTCCTTTCTAAAGGACTTAGG + Intronic
1170017257 20:11795813-11795835 ATTTTCTTTCTCAAGGATCTGGG - Intergenic
1170019723 20:11823594-11823616 AATGTCTTCCTCAAGGACCTGGG + Intergenic
1170036420 20:11994704-11994726 AATGTCTTTCTCCAGGTCCTGGG + Intergenic
1170057485 20:12222669-12222691 AGTGTTTTTCTCAAGGCCCTGGG - Intergenic
1170130070 20:13009811-13009833 GATGCATTTCTCATGGACCTGGG - Intronic
1170348861 20:15417948-15417970 CAGTTCTTTCTCAAGGACCGAGG + Intronic
1171217146 20:23360949-23360971 TATGTCTTTTTCTAGGACCTAGG - Intergenic
1172812816 20:37661954-37661976 AGTTTCTTTCTGAAGGTCCTAGG + Intergenic
1173310211 20:41890495-41890517 AATTTCTTTCTTCAGGACCTAGG + Intergenic
1173430173 20:42980863-42980885 AATGTCTTTCTCAAGGACCTGGG + Intronic
1174754380 20:53143366-53143388 AATGTGTTTCTCAGGGGCATGGG - Intronic
1174961955 20:55167642-55167664 AATCCCTTTCTCAAGGGCTTGGG - Intergenic
1176456204 21:6914119-6914141 CATTTCTTTCTCAAGGTCATGGG + Intergenic
1176834377 21:13779168-13779190 CATTTCTTTCTCAAGGTCATGGG + Intergenic
1176863867 21:14031217-14031239 ATTGTCTTAATCTAGGACCTGGG + Intergenic
1177182682 21:17759902-17759924 AATGCCTTTCTCAAGAACTCAGG + Intergenic
1177304240 21:19292107-19292129 AGTGTCTTTCTCAAGGACCTTGG + Intergenic
1177486799 21:21768720-21768742 ACTGTCTTTTTCAAGGACCTGGG + Intergenic
1177530910 21:22356597-22356619 AATGTCTTTCTCTAGCACTTGGG - Intergenic
1177697794 21:24595825-24595847 ACTGTCTTTCTCAAGGACCTGGG + Intergenic
1178184604 21:30205741-30205763 AATATCTTTCTCAAGGACCTGGG - Intergenic
1178744526 21:35236170-35236192 ACTGTCTTTCTCAAGAGACTGGG + Intronic
1178856503 21:36254608-36254630 AATGTGTTTCTCAAGGACCTGGG - Intronic
1181533332 22:23529544-23529566 AATGTCTTTCTCAAAGCCTCAGG - Intergenic
1182417742 22:30232365-30232387 AATGTCTTTGCCAACGGCCTGGG - Intergenic
1182562913 22:31175494-31175516 CATGTCATTGTCAAGGACTTAGG + Intronic
1182960327 22:34466227-34466249 AATTTCTTTCTGGAGGCCCTAGG + Intergenic
1183145802 22:35990444-35990466 ACTGGCTTTCTCAATGACATTGG + Intronic
1183596662 22:38816795-38816817 AATGGTTTTCTCAATGAACTAGG + Intergenic
1184057736 22:42063696-42063718 AATTTCTTTTTCAGGGAGCTCGG + Intronic
1184422222 22:44388919-44388941 AAGGTCTTTCTGGAGGCCCTGGG - Intergenic
1184601216 22:45544482-45544504 AGTGTCTTTCTCAAGGGCTGGGG - Intronic
1184691891 22:46121147-46121169 GCTGTCTCTCTCAAGGGCCTGGG + Intergenic
1185166155 22:49263535-49263557 CATGTCTCTATCAAGGACCTGGG + Intergenic
949211131 3:1502825-1502847 AATGCTTTTCCCAAGGACCTGGG - Intergenic
949815969 3:8058169-8058191 AATGTCTTTCTCAAGAACTTGGG - Intergenic
950327011 3:12120421-12120443 ATTGTTTTTCTCTAGGACCCAGG + Intronic
950695823 3:14700515-14700537 AATGTATTTCTCAAGGACTCGGG + Intronic
951300964 3:20995562-20995584 AATGTCTTTCTAAAGGGTCTGGG - Intergenic
951448430 3:22809506-22809528 AATGTCTTTCTAAAGGACTTGGG - Intergenic
951710173 3:25578653-25578675 TATTCCTTCCTCAAGGACCTTGG - Intronic
951825568 3:26864665-26864687 AATGTCTTTCTCAAGGACCTGGG + Intergenic
952535386 3:34303924-34303946 AATATCTTTCTCAAGTACCTAGG - Intergenic
952537781 3:34331595-34331617 AATGTCAATCTCAAGGAACTAGG - Intergenic
952558881 3:34566262-34566284 AATGTCTTTCTCAAGGACCTGGG - Intergenic
952559165 3:34569501-34569523 AATGTCTTCCTCAAGGATCTGGG + Intergenic
953043475 3:39275251-39275273 CTAGTCTTTCCCAAGGACCTGGG + Intronic
953064227 3:39454811-39454833 AATGTCCTTCTCAAGGATCTGGG - Intergenic
953292565 3:41680758-41680780 CATGGCTTTCTCCAGGGCCTGGG - Intronic
954098554 3:48351350-48351372 GATGTCTTTCTCAAAGACCTAGG - Intergenic
954423835 3:50432849-50432871 AATTTCCTTCTCCAGGAGCTGGG - Intronic
955679417 3:61485087-61485109 CACATCATTCTCAAGGACCTAGG + Intergenic
955919913 3:63944702-63944724 AATGTTTGTCTCAAGGTCCCCGG - Intronic
957023099 3:75146488-75146510 AAGGACTTTATCAAGGACTTGGG - Intergenic
957525642 3:81375520-81375542 AATATCTTTCTCAAGGACCTGGG - Intergenic
957782828 3:84841835-84841857 AATGTCTTTGTCAAGGACCTGGG + Intergenic
957892776 3:86381420-86381442 ATTGTCTTTCTCAAAGACCTGGG - Intergenic
957910609 3:86616852-86616874 AGTTTCTCTCTCAATGACCTGGG - Intergenic
958124427 3:89337093-89337115 CATGTCTTTCTCTAGGATTTAGG - Intronic
958550769 3:95609060-95609082 AGTGTCTTTGTCAAGGATCTGGG - Intergenic
959090839 3:101900911-101900933 AATGTCTTTCACAAGGACCTGGG + Intergenic
959473025 3:106775997-106776019 AATATCTTTTTCAAGGACCTGGG - Intergenic
960217990 3:115066293-115066315 GATGTTTTTCTCGAGTACCTGGG - Intronic
961393832 3:126572259-126572281 AATGTCTTTCTGGAGAGCCTGGG - Exonic
963482020 3:145887946-145887968 ATTGTGTTTCTCAAGCACCTGGG - Intergenic
965196383 3:165601747-165601769 AATGTCTTTTTAAAGGACCTGGG + Intergenic
965253625 3:166375472-166375494 AATGTCTTTCTTAAAGACCTGGG - Intergenic
966244432 3:177790822-177790844 AATGTGCTTCTCAAGGACCTAGG - Intergenic
967432008 3:189396776-189396798 AATGTCTACCTCCAGGACTTGGG + Intergenic
967628414 3:191713446-191713468 ATATTATTTCTCAAGGACCTGGG - Intergenic
968129854 3:196186711-196186733 ATTGTCTCTCCCAAGGACCGAGG - Intergenic
969258577 4:6019785-6019807 AATGTTTCCCTGAAGGACCTGGG + Intergenic
969750405 4:9106127-9106149 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
970530558 4:16978006-16978028 AATGTCTTTCTTATGCACCTGGG + Intergenic
970681443 4:18513079-18513101 GATTTTTTTTTCAAGGACCTAGG - Intergenic
970902418 4:21175185-21175207 GATGTCTTTCTCAAGGATTTGGG + Intronic
971501639 4:27324740-27324762 AATGTCTTTCTCAAGGATCTGGG - Intergenic
971998389 4:33996182-33996204 AATGTCTTCCTAAAGGATCTGGG - Intergenic
972102691 4:35442710-35442732 CCTGTCTTTCTCAAGAACCTAGG - Intergenic
972229791 4:37058287-37058309 AATGTCTTTCTCAAGGATCTGGG - Intergenic
972230738 4:37070030-37070052 AGTATCTTTCTTAAGGACCTGGG - Intergenic
972305422 4:37825948-37825970 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
972840626 4:42926004-42926026 ACTTTTTTTCTCAAGGAGCTTGG - Intronic
973077100 4:45942721-45942743 GATATCTTTCTCAAGTACCTGGG + Intergenic
973852859 4:54977988-54978010 AATGAGTTTCCCAAGGCCCTAGG - Intergenic
974029225 4:56761273-56761295 AATGGCTTTCCAAAGGACATGGG - Intergenic
974225122 4:59031988-59032010 AATGTTTTTCTTAAGCAACTGGG - Intergenic
974259095 4:59501829-59501851 AATATCTTTCTCAAGGACCTGGG - Intergenic
974319387 4:60326443-60326465 AATGTGACTTTCAAGGACCTTGG + Intergenic
974658634 4:64858193-64858215 AATGTTTTTCTCAAGAACCCGGG - Intergenic
975083042 4:70303451-70303473 TAAGTCTTTCTTAAGGACCTGGG + Intergenic
975613593 4:76224438-76224460 AATGTTTTTCTTAAGGACTTGGG - Intronic
975969307 4:80014682-80014704 ACTGTCTTTCTCAAGGCCCTGGG + Intronic
976286949 4:83380180-83380202 AAATGTTTTCTCAAGGACCTGGG - Intergenic
976852071 4:89558904-89558926 AATGTTTTTCTCAAAGACCTGGG - Intergenic
977189919 4:93986745-93986767 AATGTATTTCTCAAGAATCTGGG + Intergenic
977229839 4:94438739-94438761 AATGTCGTTATCAAGGGACTGGG - Intergenic
977302082 4:95279707-95279729 TATGTCTTTATCAGGGACCTGGG - Intronic
977529860 4:98188140-98188162 AGTGTCTCTCCCAATGACCTTGG - Intergenic
978507036 4:109469706-109469728 AATCTCTATCTCTAGAACCTTGG + Intronic
979056352 4:115999764-115999786 CAGGACTTTCTCAAGGACCTGGG + Intergenic
979163130 4:117489899-117489921 AATATCTTTCTCAAGGTCATGGG - Intergenic
979164586 4:117511578-117511600 GGTGTCTTTCTCAAGAACCTGGG - Intergenic
979187850 4:117821112-117821134 AATGTCTTTCTCAAGGACCTAGG + Intergenic
979916539 4:126441781-126441803 AATGTCTTCCTCAAGGACCTGGG - Intergenic
980222111 4:129930859-129930881 AATGTCTTTCTCAAGAGCCTGGG + Intergenic
980388524 4:132117884-132117906 AGTATCTTTCTCAAGGACCTGGG - Intergenic
980537646 4:134149566-134149588 AATGTCTTTTTCAAGGACCTGGG - Intergenic
980654288 4:135761882-135761904 AATGCCTTCCTCAAAGACCTGGG + Intergenic
980662464 4:135881276-135881298 AATATCTTTCTCCAGGTCTTGGG - Intergenic
980716050 4:136631379-136631401 AATGTCTTTCTGAAGGACCTAGG - Intergenic
980724474 4:136740727-136740749 AATGTCTTACTCTATGACCTGGG + Intergenic
980977433 4:139624647-139624669 AATGTCTTTCTCAAGGACCTGGG - Intergenic
981182966 4:141767555-141767577 CATGTATTCCTTAAGGACCTTGG + Intergenic
981242955 4:142500479-142500501 AATGCCTTTCTCAAGAACCTGGG + Intronic
981935657 4:150236525-150236547 ACTGACATTCTCAAGGACTTTGG - Intronic
982430792 4:155319763-155319785 AATGTCTTTCTTAAGTACCTGGG - Intergenic
982566484 4:156993339-156993361 AACTTCTTTCTCAAGTACCTGGG - Intergenic
982600830 4:157445827-157445849 AACGTCTTTCTCAAGAACCTGGG - Intergenic
982881770 4:160728946-160728968 ACTGTCTTTCTCAAGAATCTGGG + Intergenic
982972873 4:162013274-162013296 ACTGTCATTCCCAAAGACCTGGG - Intronic
982975576 4:162054757-162054779 AGTATCTTTTTCAAGGACCTGGG + Intronic
983469114 4:168135347-168135369 ATTGTCTTTCTCAGGGATATGGG - Intronic
983733431 4:171027338-171027360 AACTTCTTTTTAAAGGACCTTGG - Intergenic
983844788 4:172504508-172504530 AATATCTTTCTCAAGGATCTGGG - Intronic
984258080 4:177410778-177410800 AATGTCTTTCTCAAAGAACTGGG + Intergenic
985374099 4:189314964-189314986 AAGGGCTGTCTCAAAGACCTCGG + Intergenic
985732938 5:1560651-1560673 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
986207063 5:5634889-5634911 GATGACTTTCTCAAAGTCCTTGG - Intergenic
986518967 5:8593753-8593775 AATGTCTTTCTCAAGGACCTGGG + Intergenic
986922506 5:12704699-12704721 AATGTCTTTCTCAAGGACCTGGG + Intergenic
986968532 5:13304264-13304286 AATGTTTTTCTGAAGGATCTGGG - Intergenic
987617283 5:20292635-20292657 CATGTCTTTGTGAAGGACATGGG + Intronic
987700884 5:21396558-21396580 AATGTCTTTCTAAAGGATTTTGG - Intergenic
987841692 5:23230939-23230961 AATATCTTTCTCAGAGACCTGGG + Intergenic
987911239 5:24148918-24148940 AATGGCATTCACAATGACCTGGG - Intronic
988176090 5:27727480-27727502 AATACCTTTCTCAAGAACCTGGG + Intergenic
988184662 5:27845180-27845202 AATATCTTTCTCAACCACTTAGG - Intergenic
988251444 5:28763299-28763321 AATTTCTTTCCCCAGGATCTGGG - Intergenic
988304087 5:29471632-29471654 AATGTCTTTCTCAAGGACCCAGG - Intergenic
988991850 5:36679345-36679367 AATGTTTTTCTCTTAGACCTGGG - Intronic
991138284 5:63209258-63209280 CATATCTTTCTCAAGGACCTAGG + Intergenic
991192101 5:63886345-63886367 AGTGTCTTTCTCAGGGACCTGGG - Intergenic
991292677 5:65047895-65047917 CATATCTTTCTCAGGTACCTAGG - Intergenic
991440865 5:66647356-66647378 GATGTCGTACTCAAGGACATGGG - Intronic
993206347 5:84885136-84885158 ACTGTCTCTCTCAAGGGCCTGGG - Intergenic
993236994 5:85323994-85324016 AATATCTTTCTTTAGAACCTGGG - Intergenic
993294267 5:86114496-86114518 AATGTTTTCCTCAAAGACCTTGG - Intergenic
993772113 5:91941747-91941769 AATGTCTCTCTCAATGACTTGGG + Intergenic
993980209 5:94535624-94535646 AATGTCTTTCTCAAGAACCTGGG + Intronic
994560993 5:101372149-101372171 AACATCATTCTAAAGGACCTGGG - Intergenic
994599196 5:101880698-101880720 AATGTCTTTCTCAAGCACCTGGG + Intergenic
994625777 5:102216731-102216753 AATGTCTTTCTCAAATAGCTAGG + Intergenic
994831858 5:104793814-104793836 GAAATGTTTCTCAAGGACCTGGG + Intergenic
995274420 5:110262055-110262077 ACTGTTTTTCTTAAGAACCTGGG + Intergenic
995358092 5:111262428-111262450 AATGTCTTTCTCAAGAACCTGGG - Intronic
995381192 5:111535260-111535282 ACTGTCCTTCTCAAGGACCTTGG - Intergenic
995543688 5:113208517-113208539 ACTTTCTTTCTCAAAGAACTAGG + Intronic
995958146 5:117805268-117805290 AATGTCTTTCCCAAGGACCTGGG - Intergenic
995966250 5:117911143-117911165 AATATCTTTCTTAAGGGCCTAGG + Intergenic
996214624 5:120851648-120851670 AATGTCTTTCTCAAGGTCATAGG + Intergenic
996227782 5:121022480-121022502 AATGTTATTCTTCAGGACCTGGG - Intergenic
996237153 5:121144798-121144820 AGTGTCTTCGTCAAGGACTTAGG + Intergenic
997043567 5:130286479-130286501 AATGTCTTTCTCTAGGACCTGGG - Intergenic
997522701 5:134533428-134533450 TATGTCTTTCCCAAGGTCCCTGG + Intronic
998508171 5:142689097-142689119 AATGTCATTCTCAAGAATCAAGG - Intronic
998787192 5:145725798-145725820 AAAGTCTTGCTCAAGGATCTTGG - Intronic
1000220025 5:159206204-159206226 AATGTTTTTAACAAGGACTTTGG + Intronic
1000587066 5:163113356-163113378 GATGTCTTTCTAAAGGACCTGGG - Intergenic
1000766466 5:165297171-165297193 AATGTCTTTCTCAAAGATCTAGG - Intergenic
1001059190 5:168473928-168473950 AAGGTTTTTCTCAGGGCCCTTGG + Intergenic
1002465923 5:179408594-179408616 CATGTCTTCCTCAAGGACAAGGG - Intergenic
1002474640 5:179457374-179457396 ATGGTCTTTCTGAAGGTCCTAGG - Intergenic
1004124815 6:12862970-12862992 AATGACTTGCTCAAGGACACAGG - Intronic
1007334069 6:41138729-41138751 AATGTCTTACTCAAGGGCTGTGG + Intergenic
1008170796 6:48202915-48202937 AATATCTTTCTCAAGGACCTGGG + Intergenic
1008277395 6:49557599-49557621 TATGTCTTTCTTGAGGACCTAGG + Intronic
1008278115 6:49564465-49564487 AATGTCTTTCTCAAGGGCTTAGG + Intergenic
1008279599 6:49580419-49580441 AATGCCTTTCTCAGGGACTTGGG + Intergenic
1008306116 6:49902163-49902185 AACATCTTTCTCAAGAACTTTGG + Intergenic
1009266878 6:61567168-61567190 AATATCTTTCTCAAGAACATGGG - Intergenic
1009288048 6:61847364-61847386 ACTGTCTTTCTCAGGCACTTGGG + Intronic
1009335117 6:62478245-62478267 ACTGTCTTTCTCAAGGACATGGG + Intergenic
1009399429 6:63236918-63236940 AATGTCCTTCTCAAAGACCTGGG - Intergenic
1009548823 6:65059545-65059567 ACTATCTTTCTCAAGGACCTGGG - Intronic
1009568065 6:65339817-65339839 GATGTCTGTATCAAGGACCTTGG - Intronic
1009682977 6:66922882-66922904 AATGTTTCTTTCAAGGATCTGGG + Intergenic
1009759585 6:67986886-67986908 AATATCTGTCTCAAGTATCTGGG + Intergenic
1009865631 6:69394284-69394306 GGAGTCTTTCTCAAGGACCTTGG - Intergenic
1009878930 6:69540764-69540786 AATGTCTTTCTCAAGGACCTTGG - Intergenic
1009926679 6:70128956-70128978 AACGTCTTTCTCAAGGATCTGGG - Intronic
1010136414 6:72559280-72559302 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1010274819 6:73957133-73957155 AATGTCTTTCTCCGGTACCTGGG + Intergenic
1010502141 6:76614193-76614215 GATGTCTTTTTCAAGGACTTGGG + Intergenic
1010542252 6:77106276-77106298 GGTGTCTTTCTTAAGGACCTGGG - Intergenic
1010622567 6:78094256-78094278 AATGTCTCTCTCAAGGACCTGGG - Intergenic
1010791149 6:80066756-80066778 AATGTCTTTCTCATGATACTTGG + Intergenic
1010863421 6:80941810-80941832 AATGTCTTTCTCAAAGACCTGGG + Intergenic
1011078386 6:83462616-83462638 AATGTCTTTCTCAAGGACCTGGG - Intergenic
1011941536 6:92849035-92849057 AAGGTCTTTCTCAAGGAACTAGG + Intergenic
1012229117 6:96739796-96739818 GAAGTCTTTCTCAAGAACCTGGG - Intergenic
1012235215 6:96806086-96806108 AATCTCGTTCACAGGGACCTTGG + Intronic
1012619919 6:101330802-101330824 AATATCTTTCTCAAGGACCTGGG - Intergenic
1012658780 6:101859767-101859789 AAAGCCTTTCTCAAGGACCTGGG - Intronic
1012664267 6:101946977-101946999 AACGTTTTGCTCAAGGTCCTAGG - Intronic
1012733381 6:102909842-102909864 AATGCCTTTCTAAAGGGTCTGGG - Intergenic
1012745824 6:103087390-103087412 GTTGTCTTTCTCAAGTACCTGGG - Intergenic
1012765982 6:103367377-103367399 AATGTCTTTCTCAAGGACCTGGG - Intergenic
1012793015 6:103724276-103724298 AATGTCCTTCTCAAGAACTTGGG - Intergenic
1012804378 6:103876328-103876350 AATGTCTTTCTTAAGAACCTGGG - Intergenic
1012811187 6:103960510-103960532 AATGTCTTTCTTAAGGACCTGGG - Intergenic
1013927116 6:115486646-115486668 AATGTCTTTCTCCAGGATGTGGG - Intergenic
1013952624 6:115802920-115802942 GATGTCTTTCTTAAGGAGCTGGG - Intergenic
1013952867 6:115806082-115806104 GATGTCTTTCTCAAGGAGCTGGG - Intergenic
1014652197 6:124053513-124053535 ATTGTCTTTGACAAGGACTTTGG - Intronic
1015379083 6:132546344-132546366 AATGTCTTTCTCAAGGTCCTGGG - Intergenic
1015859851 6:137664234-137664256 AATGTCATTCTCAAGAACTTTGG - Intergenic
1016225402 6:141729355-141729377 AATAAATTTCTCAAGGACCTGGG + Intergenic
1016236863 6:141878462-141878484 AATGTCTTTCTCAAATACCTGGG - Intergenic
1017263759 6:152418247-152418269 AATATTTTTCTGAAGGACCTGGG + Intronic
1017373244 6:153737260-153737282 AATGTATTTCTCAAGCACCTGGG - Intergenic
1018461226 6:164000692-164000714 AGTGTATTTTTCAAGTACCTAGG + Intergenic
1019493934 7:1328071-1328093 AATTTCTTTCTTAGGGAGCTCGG + Intergenic
1020322576 7:6950511-6950533 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1020520553 7:9180628-9180650 AATGTCTTTCTCAAGTACCTGGG - Intergenic
1020531823 7:9347809-9347831 AATATTTTTCTCAAGGACCTGGG - Intergenic
1020675965 7:11185468-11185490 AATGTCTTTCTCAAGGACCTAGG - Intergenic
1020701496 7:11489482-11489504 ATTATCTTTCTCAAGGAAATAGG + Intronic
1020741520 7:12025359-12025381 AATGTCTTTTTCAAGGACCTGGG + Intergenic
1021114989 7:16737538-16737560 AATGCCTTTTTCAAGGAACTAGG + Intergenic
1021845695 7:24760329-24760351 AATGTGGTTCTCAAGGAACTAGG - Intergenic
1022077206 7:26983686-26983708 ATTGTCATTCTCAAGGCCCCAGG + Intronic
1022542398 7:31149887-31149909 ATTATTTTTCTCAAGGATCTTGG + Intergenic
1023082090 7:36535484-36535506 AATGTCTTTTTAAAATACCTTGG - Intronic
1023642035 7:42268883-42268905 AAAGTTTCTCCCAAGGACCTTGG + Intergenic
1024035221 7:45502361-45502383 GATGTCCTTCTCAAAGACCTGGG + Intergenic
1024142455 7:46475866-46475888 AATGTCCTTCACATGGACCCAGG + Intergenic
1024562944 7:50659991-50660013 GATGTATTTGTCAATGACCTTGG + Intronic
1024899050 7:54296039-54296061 AATTCCTTTCTAAGGGACCTGGG - Intergenic
1025003327 7:55336585-55336607 GATGCTTTTCTCAAGTACCTGGG + Intergenic
1025253648 7:57368701-57368723 AATTTCTTTTTCAAGGAGCTCGG + Intergenic
1025554799 7:62293439-62293461 AATGTATTTCTCAAACTCCTAGG - Intergenic
1026593832 7:71717801-71717823 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1027596680 7:80183069-80183091 AATGTCTTTCTCAAGGACCTGGG - Intronic
1028067730 7:86408560-86408582 AATGTATTTCTCAATTAACTAGG - Intergenic
1028258827 7:88635322-88635344 ATTGTCTTTCTCAAGGATCCAGG - Intergenic
1028308890 7:89304126-89304148 AATGTCTTTCCCAAAGTCCTGGG + Intronic
1028325673 7:89521797-89521819 AATTTCTTTCTCAAGGATCTGGG - Intergenic
1028587532 7:92466946-92466968 AATGTCTTTCTCAAGGATCTGGG - Intergenic
1029797628 7:102911594-102911616 AAAGTCTTCCTCAAGGACCTGGG - Intronic
1029801020 7:102947897-102947919 AATATCTTTCTCAAGTAACTAGG - Intronic
1029953649 7:104614028-104614050 AAAGTCTTTCTCAAGGACCTGGG - Intronic
1030414984 7:109231732-109231754 AGTGTCTTTCTCTAGGACCTGGG + Intergenic
1030519033 7:110574161-110574183 AACGTCTTTCTCATGAACCTGGG - Intergenic
1030762276 7:113366309-113366331 AATGTCTTTCTGAAGGACCTGGG - Intergenic
1030782261 7:113616003-113616025 AATATCTTTCTCAAGGACCTGGG - Intergenic
1030794051 7:113765364-113765386 AATGTCTTTCTCAAAGGTCTGGG - Intergenic
1030799029 7:113826774-113826796 AATCTCTTTCTCAAGGACCTGGG - Intergenic
1030909282 7:115226571-115226593 AACGTCTTTCTCAAAGACCTGGG + Intergenic
1030938897 7:115620240-115620262 AATGTCTTTCTCAAGGACCTTGG - Intergenic
1031190272 7:118540310-118540332 AATATCATTCTTTAGGACCTGGG - Intergenic
1031258387 7:119485296-119485318 AATGTCTTAGCCAAGGACCTAGG - Intergenic
1031451459 7:121925930-121925952 AATGTACCTCTCAAGGACCTGGG - Intronic
1031452465 7:121938599-121938621 GATGTTTTTCTCAAGGACCCGGG - Intronic
1031570556 7:123354036-123354058 AATATCTTTCTCAAGGACCTGGG - Intergenic
1031648941 7:124261876-124261898 ACTGTCTTTCGCAAGGACCTAGG + Intergenic
1032425466 7:131819147-131819169 AATGTCTTCTTCAAGAACCTGGG - Intergenic
1033087174 7:138353201-138353223 AATATGTTTTTCAAGGACCTGGG - Intergenic
1033536342 7:142315309-142315331 AATGTCTTTCCCAAGACTCTAGG - Intergenic
1033810428 7:145005125-145005147 AAAACCTTTCTCCAGGACCTTGG + Intergenic
1033832860 7:145274648-145274670 ACTGTCTTTCTCAAAGACTTGGG - Intergenic
1033940915 7:146652291-146652313 AATGAATTTATCAAGGACATGGG + Intronic
1034055534 7:148031217-148031239 AGTGTTTTTCTTAAGGACCCGGG - Intronic
1034346062 7:150385910-150385932 ACTGTCTTTCCCAAGGTCCTGGG - Intronic
1034682019 7:152936123-152936145 AATGCCTTTCTCCAGGACCTGGG + Intergenic
1034687804 7:152988942-152988964 AGTGACTTTCTCAAGGACCTAGG + Intergenic
1034720628 7:153289504-153289526 ACTGTCTTTTTCAAGGACCTGGG - Intergenic
1035188353 7:157143449-157143471 CTTGTCTTTCTCCAGGAGCTGGG + Intronic
1035757238 8:2043437-2043459 AATCCATTTCTCAGGGACCTGGG - Intergenic
1035837475 8:2770180-2770202 AATATCTATCTCAAGGACATTGG - Intergenic
1036017015 8:4796498-4796520 ATGGTCTTTCTCAATGACCTGGG + Intronic
1036126073 8:6063502-6063524 ACCGTCTTTCTCAAGGATCTGGG + Intergenic
1036373468 8:8180459-8180481 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1036449863 8:8856298-8856320 AGTGTCTTTCTCATGGCACTGGG + Intronic
1036877437 8:12485182-12485204 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1037018203 8:13934443-13934465 ACTATCTTTCTCAAGGATTTGGG + Intergenic
1037061122 8:14510854-14510876 AATGTCTTCATTAAGGACTTGGG + Intronic
1037094818 8:14973203-14973225 AATATCTTTCTCAAAAACCCAGG + Intronic
1037196623 8:16198671-16198693 AGTGTCTTCTTCAATGACCTGGG + Intronic
1037380115 8:18276112-18276134 AACATCTTTTTCAAGGACCTGGG + Intergenic
1038876272 8:31553687-31553709 AATGTCTTTCCATAGTACCTGGG - Intergenic
1039866591 8:41510014-41510036 AATGTTTTTCTCCAGGATTTTGG + Exonic
1041348073 8:56921936-56921958 TATGTATTTCTCAAGGACTAGGG - Intergenic
1041984664 8:63908302-63908324 AATTTCATTCTCTAGGACTTGGG - Intergenic
1043064558 8:75551266-75551288 AAAGTCTTTCTAAAAGACCTTGG - Intronic
1043223088 8:77691505-77691527 AATGTCATTTTCAGTGACCTGGG + Intergenic
1043247859 8:78028525-78028547 AATGTCTTTCTTAAGGACTTGGG - Intergenic
1043287347 8:78550344-78550366 AATGTCTTTCTGATAGACCTGGG - Intronic
1043628984 8:82303824-82303846 AATGTCTTTCTCAAGGAACTGGG - Intergenic
1043642078 8:82466598-82466620 AATGGCATTCACAAAGACCTGGG - Intergenic
1043690119 8:83140875-83140897 GATGCCTTTCTCAAGTACCTGGG - Intergenic
1043718593 8:83514655-83514677 AATGTCTTTCTCAAAAATCCAGG + Intergenic
1043759975 8:84056040-84056062 AATGTCTTTATCAAGGAACTAGG - Intergenic
1043767271 8:84151669-84151691 AATGTCTTTCTCAAGAACCCGGG + Intergenic
1043814358 8:84783651-84783673 AATGTCTTTCTCAAGGACCTGGG - Intronic
1043952221 8:86321964-86321986 AATGTCTTTCTCAACACCCCAGG - Intergenic
1044012008 8:87005898-87005920 AATGTATTTTTCAAACACCTGGG - Intronic
1044076880 8:87832638-87832660 ACTGTCTTTCTCAGGGACCTGGG + Intergenic
1044100357 8:88128583-88128605 AATGTCTTTCTCTGGGATTTGGG + Intronic
1044118649 8:88366379-88366401 AATGTCTCTCACAAGGACCTAGG - Intergenic
1044201392 8:89442525-89442547 AATGCCTTTCTTAAGAACCTGGG + Intergenic
1044210720 8:89547001-89547023 AATGTCTTTCTCTAAGATTTAGG + Intergenic
1044585684 8:93867340-93867362 AATGACTTTCCCAAGGAACTGGG - Intronic
1045801173 8:106103265-106103287 GATGTCTTTCTCAAGGACCTGGG - Intergenic
1045822454 8:106356215-106356237 AATGTATTTCTCAAGGACCTGGG - Intronic
1046059398 8:109118641-109118663 AGTGTCTCTCTAAAGGCCCTAGG + Intronic
1046183044 8:110677496-110677518 ATTGTCTTTCTCAAGGACTCGGG - Intergenic
1046258448 8:111732795-111732817 AATGCCTTTCTCAAAAACTTGGG + Intergenic
1046327672 8:112671316-112671338 AATGTCTTTTTCAATGACCTGGG + Intronic
1046494267 8:114993972-114993994 AATGTCTTTCCCACGAACCTGGG + Intergenic
1046732314 8:117738785-117738807 AATGCCTTTCTCAAGGCACAGGG + Intergenic
1047068745 8:121318062-121318084 AATGTTTTTCTCAAAGAGCCTGG - Intergenic
1047151322 8:122266707-122266729 AATGTCCTTCTCAAGGATTTGGG + Intergenic
1047160992 8:122379128-122379150 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1047404148 8:124571063-124571085 AATTTCTTCCTCAAGGATGTAGG + Intronic
1048667951 8:136685393-136685415 AATGTCTTTTTCAGGAACCTAGG + Intergenic
1048850380 8:138639735-138639757 AATGTCTTTCTGAAGGACCTAGG + Intronic
1048851389 8:138648613-138648635 AATGTCTTTCTCTAGGAGTTAGG + Intronic
1049860551 8:144895355-144895377 TATGTGTGTCACAAGGACCTGGG + Intronic
1050362788 9:4846701-4846723 CATGTCTTTCTAATAGACCTTGG + Intronic
1050834143 9:10054573-10054595 AAGGTCTTTTTCAAGGACGTGGG + Intronic
1050959389 9:11707693-11707715 ACTGTTTTTCTTAAGGACCTGGG - Intergenic
1051007195 9:12360015-12360037 AATGCCTTTCTCAAAGACCAGGG + Intergenic
1051066066 9:13104520-13104542 AACTTCTTTCTGAAGGCCCTAGG + Intergenic
1052202677 9:25801886-25801908 CATTTCTTTTTCAAGGACCTGGG - Intergenic
1052216709 9:25974703-25974725 AATGTTTCCCTCAAGGACCTAGG + Intergenic
1052388169 9:27846816-27846838 AGTATCTTTCTCAAGGACCTGGG + Intergenic
1052427586 9:28325300-28325322 AAAGTCTTTTTTAAGGACCTAGG + Intronic
1052544801 9:29863188-29863210 ACTGTCTTTCTCAAGGGCCTGGG - Intergenic
1052692154 9:31828535-31828557 AATGTCTTTCTGAAATACCTGGG + Intergenic
1052705193 9:31986723-31986745 ACTATCTTTCTCAAAGCCCTTGG - Intergenic
1052785221 9:32822051-32822073 AATATCGTTCTTAAGGATCTGGG + Intergenic
1053558943 9:39169508-39169530 AGTGTTTTTCTTGAGGACCTTGG + Intronic
1053572760 9:39327168-39327190 AATGTCTTTCTCAAAGACTTAGG - Intergenic
1053624111 9:39851389-39851411 AATGTCTTTCTGAAAGACTTGGG - Intergenic
1053823065 9:41989755-41989777 AGTGTTTTTCTTGAGGACCTTGG + Intronic
1053880758 9:42591840-42591862 AATGTCTTTCTGAAAGACTTGGG + Intergenic
1053891916 9:42702493-42702515 AATGTCTTTCTGAAAGACTTGGG - Intergenic
1053935899 9:43151096-43151118 CATTTTTCTCTCAAGGACCTGGG + Intergenic
1054094322 9:60885878-60885900 AATGTCTTTCTCAAAGACTTAGG - Intergenic
1054115793 9:61161785-61161807 AATGTCTTTCTCAAAGACTTAGG - Intergenic
1054124384 9:61291843-61291865 AATGTCTTTCTCAAAGACTTAGG + Intergenic
1054138168 9:61449435-61449457 AGTGTTTTTCTTGAGGACCTTGG - Intergenic
1054219786 9:62399310-62399332 AATGTCTTTCTGAAAGACTTGGG + Intergenic
1054230929 9:62509863-62509885 AATGTCTTTCTGAAAGACTTGGG - Intergenic
1054591963 9:67020757-67020779 AATGTCTTTCTCAAAGACTTAGG + Intergenic
1054607508 9:67197611-67197633 AGTGTTTTTCTTGAGGACCTTGG - Intergenic
1054965242 9:71018254-71018276 AAGGTCTATCTCAAGAAGCTAGG + Intronic
1055648103 9:78379765-78379787 AATGTCTTTCTCAAGGGCCCAGG - Intergenic
1055650341 9:78400622-78400644 AATTTCTTTCTGAGGGTCCTGGG + Intergenic
1058196561 9:101984077-101984099 AATGTCTTTTTTAAGAACCTGGG - Intergenic
1058228393 9:102395211-102395233 ACTGTCTTTCTCAAAGACTTAGG - Intergenic
1058281622 9:103123424-103123446 AATGTGTTTCTCAGGAACCTGGG - Intergenic
1058282528 9:103133122-103133144 AATGTCTTTCTCAAACATCTGGG - Intergenic
1058489781 9:105485380-105485402 AATGTCTTTCTCAAAAGACTGGG - Intronic
1058531884 9:105914181-105914203 AGTATCTTGCTCAAGGTCCTGGG + Intergenic
1058536283 9:105963570-105963592 AATGCCTTTCTCAAATGCCTGGG - Intergenic
1059204958 9:112455929-112455951 AATGTCTATACCAAGTACCTGGG + Intronic
1059702356 9:116787388-116787410 ACTGTCTTTCTCAAGGACGTGGG + Intronic
1059914799 9:119086803-119086825 AAGGACTTTCTCAAGGACCTGGG - Intergenic
1060308742 9:122440130-122440152 AATGTCTTTCTCACGGTCCTGGG + Intergenic
1060318864 9:122536692-122536714 AATGTCTTTCTCAAGGACCTGGG + Intergenic
1061247136 9:129406296-129406318 AATGTCTTTCTCAAAGCCTCAGG + Intergenic
1061915931 9:133754045-133754067 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1062264460 9:135680428-135680450 AATTTCTTTTTCGGGGACCTCGG - Intergenic
1062558393 9:137127738-137127760 AATTTCTTTTTCAGGGAGCTCGG - Intergenic
1185451944 X:286538-286560 AATTTCTTTTTTAAGGAGCTCGG - Intronic
1185575714 X:1170605-1170627 AATTTCTTTCTCGGGGAGCTCGG - Intergenic
1186230544 X:7449160-7449182 AGTGTCTTCCTTAAGGACCTGGG + Intergenic
1186300226 X:8192658-8192680 AATGTTTTTTTCAAAGTCCTAGG - Intergenic
1186365199 X:8885424-8885446 AATGTCTTTCTCAAGAACTTAGG + Intergenic
1186952873 X:14646916-14646938 ACTGTCTTTTACAAGGTCCTGGG - Intronic
1188053968 X:25520606-25520628 CATGTCTTTTGCAGGGACCTGGG + Intergenic
1188093870 X:25998220-25998242 AATATCTTTCTTAGGAACCTAGG - Intergenic
1188117132 X:26258223-26258245 ACTGTCTTTCGTAAGGACCCTGG - Intergenic
1188357080 X:29204851-29204873 AATGAATTTCTCAAGGGCCTAGG - Intronic
1188358724 X:29225806-29225828 AAATTCTTTCTCAAGGACCTGGG - Intronic
1188376256 X:29432315-29432337 AATGTCTTTCCCAAAGATCTGGG + Intronic
1188647091 X:32582869-32582891 AATATCTTTCTCAAGGACCTAGG + Intronic
1189765042 X:44362806-44362828 AATTTCTTTTTCAGGGAGCTCGG + Intergenic
1190172940 X:48126133-48126155 AATGTCTTTCTTTAGGGCCTTGG - Intergenic
1190178517 X:48171371-48171393 AATGTCTTTCTTCAGGGCCTTGG - Intergenic
1190184901 X:48225073-48225095 AATGTCTTTCTTCAGGGCCTTGG - Intronic
1190192651 X:48290585-48290607 AATGTCTTTCTTCAAGGCCTTGG + Intergenic
1190197480 X:48331949-48331971 AATGTCTTTCTTCAGGGCCTTGG - Intergenic
1190198623 X:48341573-48341595 AATGTCTTTCTTCAGGGCCTTGG + Intergenic
1190539756 X:51464918-51464940 AATGTCTTTCTCAAGAACCTGGG + Intergenic
1190664221 X:52682364-52682386 AATGTCTTTCTTCAGGGCCTTGG - Intronic
1190665393 X:52691983-52692005 AATGTCTTTCTTCAGGGCCTTGG + Intronic
1190674029 X:52766436-52766458 AATGTCTTTCTTCAGGGCCTTGG - Intronic
1190675201 X:52776058-52776080 AATGTCTTTCTTCAGGGCCTTGG + Intronic
1190677558 X:52795199-52795221 AATGTCTTTCTTCAGGGCCATGG - Intergenic
1192107524 X:68329649-68329671 AATATTTTTCTTAAGGACCTGGG + Intronic
1192657216 X:73003913-73003935 AACGTCTTCATCAAGAACCTGGG + Exonic
1192664904 X:73079094-73079116 AACGTCTTCATCAAGAACCTGGG - Exonic
1193008263 X:76645127-76645149 AATGTCTTTCTCAGGAACCTGGG + Intergenic
1194224103 X:91233636-91233658 AATGTCTTTATCAAGAAATTGGG + Intergenic
1194338719 X:92682460-92682482 AAAGTCTTACCCAAGGACCATGG + Intergenic
1194880597 X:99246615-99246637 AATGTCTGTCTTATGGACCTGGG - Intergenic
1195697702 X:107679007-107679029 GCTGTCTTTCTCTAGGATCTGGG - Intergenic
1196014464 X:110922995-110923017 GATGTTCTTCTCAAGGACCCAGG - Intergenic
1196120221 X:112042181-112042203 ATTGTCTTTTGCAAGGACTTTGG + Intronic
1196628777 X:117910727-117910749 AATGTCTTTCTTAAGGGCAGAGG + Intronic
1196937679 X:120745729-120745751 AATGTCTTTCTCATGAGACTGGG - Intergenic
1197661538 X:129179066-129179088 AATGTCTCACCCAAGGCCCTTGG + Intergenic
1197717849 X:129722360-129722382 AATTTCTTTCTCAGGGACTCTGG - Intergenic
1198455911 X:136817530-136817552 AATGTCTTTCTCAAGGACCTGGG - Intergenic
1198469878 X:136936268-136936290 AATTTCTTTTTCAGGGAGCTTGG - Intergenic
1199191163 X:144972733-144972755 AATGTATTTCTCACAGATCTAGG - Intergenic
1200560567 Y:4697003-4697025 AATGTCTTTATCAAGAAATTGGG + Intergenic
1200647108 Y:5799240-5799262 AAAGTCTTACCCAAGGACCATGG + Intergenic
1201922533 Y:19249490-19249512 AATATCTTCCTGCAGGACCTTGG - Intergenic
1202152048 Y:21852325-21852347 AATCTCTCTCTCAGGGAGCTTGG - Intergenic
1202264311 Y:23001919-23001941 AATATCTTCATCAAGCACCTTGG + Intronic
1202417302 Y:24635661-24635683 AATATCTTCATCAAGCACCTTGG + Intronic
1202453484 Y:25034425-25034447 AATATCTTCATCAAGCACCTTGG - Intronic