ID: 927409041

View in Genome Browser
Species Human (GRCh38)
Location 2:22804612-22804634
Sequence CAATGTCTTTCTCAAGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409041_927409049 27 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data
927409041_927409045 -6 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409045 2:22804629-22804651 ACATTGAAGGGCTGTGAAAGTGG No data
927409041_927409050 28 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409050 2:22804663-22804685 GAGAAGATTTACATCTCAAAGGG No data
927409041_927409047 5 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG No data
927409041_927409046 1 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data
927409041_927409051 29 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281
927409041_927409048 6 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409048 2:22804641-22804663 TGTGAAAGTGGCAAGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409041 Original CRISPR CAATGTCTTTCTCAAGGACC TGG (reversed) Intergenic
No off target data available for this crispr