ID: 927409044

View in Genome Browser
Species Human (GRCh38)
Location 2:22804618-22804640
Sequence GCCCTTCAATGTCTTTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409044_927409047 -1 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409047 2:22804640-22804662 CTGTGAAAGTGGCAAGAGGCTGG No data
927409044_927409046 -5 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data
927409044_927409048 0 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409048 2:22804641-22804663 TGTGAAAGTGGCAAGAGGCTGGG No data
927409044_927409049 21 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data
927409044_927409051 23 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281
927409044_927409050 22 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409050 2:22804663-22804685 GAGAAGATTTACATCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409044 Original CRISPR GCCCTTCAATGTCTTTCTCA AGG (reversed) Intergenic
No off target data available for this crispr