ID: 927409045

View in Genome Browser
Species Human (GRCh38)
Location 2:22804629-22804651
Sequence ACATTGAAGGGCTGTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409041_927409045 -6 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409045 2:22804629-22804651 ACATTGAAGGGCTGTGAAAGTGG No data
927409040_927409045 -5 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409045 2:22804629-22804651 ACATTGAAGGGCTGTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409045 Original CRISPR ACATTGAAGGGCTGTGAAAG TGG Intergenic
No off target data available for this crispr