ID: 927409046

View in Genome Browser
Species Human (GRCh38)
Location 2:22804636-22804658
Sequence AGGGCTGTGAAAGTGGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409041_927409046 1 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data
927409040_927409046 2 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data
927409044_927409046 -5 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409046 2:22804636-22804658 AGGGCTGTGAAAGTGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409046 Original CRISPR AGGGCTGTGAAAGTGGCAAG AGG Intergenic
No off target data available for this crispr