ID: 927409049

View in Genome Browser
Species Human (GRCh38)
Location 2:22804662-22804684
Sequence GGAGAAGATTTACATCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409044_927409049 21 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data
927409040_927409049 28 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data
927409041_927409049 27 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409049 2:22804662-22804684 GGAGAAGATTTACATCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409049 Original CRISPR GGAGAAGATTTACATCTCAA AGG Intergenic
No off target data available for this crispr