ID: 927409051

View in Genome Browser
Species Human (GRCh38)
Location 2:22804664-22804686
Sequence AGAAGATTTACATCTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 18, 1: 36, 2: 85, 3: 92, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927409040_927409051 30 Left 927409040 2:22804611-22804633 CCCAGGTCCTTGAGAAAGACATT 0: 36
1: 95
2: 138
3: 205
4: 400
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281
927409041_927409051 29 Left 927409041 2:22804612-22804634 CCAGGTCCTTGAGAAAGACATTG No data
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281
927409044_927409051 23 Left 927409044 2:22804618-22804640 CCTTGAGAAAGACATTGAAGGGC No data
Right 927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG 0: 18
1: 36
2: 85
3: 92
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927409051 Original CRISPR AGAAGATTTACATCTCAAAG GGG Intergenic
901444089 1:9296708-9296730 GGAAGCATCACATCTCAAAGAGG + Intronic
903088488 1:20886272-20886294 AGAAGATGTACACCTGAAAAAGG - Exonic
904297285 1:29528222-29528244 GGAAGTTCTGCATCTCAAAGGGG + Intergenic
904686512 1:32264726-32264748 AGAAAATTTGCATCTAAATGAGG - Intronic
907849643 1:58243418-58243440 ACATGATTCCCATCTCAAAGGGG - Intronic
908001142 1:59681005-59681027 AGAATATTTCCATGCCAAAGAGG - Intronic
908463416 1:64368051-64368073 AGAAAATTGATATCTCAAATAGG - Intergenic
909136102 1:71802512-71802534 AGATTATTTACTTCTCAGAGAGG + Intronic
910997915 1:93128893-93128915 AAAAGAATTCCATCTCAGAGTGG - Intronic
911326585 1:96475517-96475539 AAAAGATTTACATCTCAAAGGGG - Intergenic
911462226 1:98205539-98205561 AGAAGATTTACATGTCAAAGAGG + Intergenic
911545757 1:99214468-99214490 AAAAAATTTACATCTCAGAGAGG + Intergenic
912147112 1:106807560-106807582 AGAAGATTCACATCTCAAATAGG + Intergenic
913482607 1:119303359-119303381 AGCAGAATTACATCAAAAAGTGG - Intergenic
914948219 1:152085812-152085834 AGAGGATGTACAGCTCACAGAGG - Exonic
915696766 1:157751331-157751353 AGAAGATTTATATCTCAAGGAGG + Intronic
916044331 1:160987788-160987810 AGAAGATTTACATCTCAAAGAGG - Intergenic
916069402 1:161161086-161161108 AGAAGTGCTACGTCTCAAAGTGG - Exonic
918734766 1:188046133-188046155 AGAAACCTTAAATCTCAAAGAGG + Intergenic
918769839 1:188543121-188543143 AATAGAAGTACATCTCAAAGAGG - Intergenic
918989106 1:191674903-191674925 AGAAGATTTACATCTCAAAGGGG - Intergenic
919053186 1:192536701-192536723 TGTAGATTTCCATTTCAAAGGGG + Intergenic
919167678 1:193916634-193916656 AGAAAATTTACATGTAAAAGGGG - Intergenic
919824944 1:201496831-201496853 AGAAGAGTTACCTCTAAGAGAGG + Intronic
921139416 1:212291944-212291966 ACTAGTTTTACATCCCAAAGTGG - Intronic
921323216 1:213964005-213964027 ATAAAATCAACATCTCAAAGAGG + Intergenic
921703749 1:218295999-218296021 AGATGATTTACAGCTGAATGGGG + Intronic
922371424 1:224914015-224914037 AGCAAATTTACATTTCATAGAGG - Intronic
923476113 1:234332782-234332804 AGGATATTTACATCTAGAAGGGG - Intergenic
1063849314 10:10166674-10166696 AAAAGATTTACATCTCAAAGAGG - Intergenic
1064512782 10:16113419-16113441 AGAAGACTTACATCTCAGAGGGG + Intergenic
1065705851 10:28471023-28471045 AGAAAGTTTACTTCTCATAGAGG - Intergenic
1068003828 10:51369539-51369561 AGAAGATCTTCATCTGACAGAGG + Intronic
1068047871 10:51910452-51910474 AGAAGATTTTCATCACAAAGAGG + Intronic
1068056622 10:52019438-52019460 GGAAGATTTACATCTCAAAGGGG + Intronic
1068401659 10:56535518-56535540 AGAAGATTTGCATCTCAAAGAGG + Intergenic
1068447624 10:57143262-57143284 AAAAGATTTACATCTCAAAAGGG - Intergenic
1068824425 10:61418426-61418448 GGGAAATTTACATTTCAAAGGGG + Intronic
1069170460 10:65221995-65222017 AGAAGACTTACATCACAGAAGGG + Intergenic
1069176388 10:65294345-65294367 AAAAGATTTCCATTTCAAAGGGG - Intergenic
1069359535 10:67625838-67625860 AAAGGATTTACATCTCCAAGGGG - Intronic
1070929804 10:80253055-80253077 AGAAGACTTACAGCTCCAGGAGG - Intergenic
1071536154 10:86432535-86432557 AGATGATTGAAATCTTAAAGGGG - Intergenic
1071888826 10:89980338-89980360 AGATGATTTACATCTCAAAAGGG + Intergenic
1073672535 10:105608161-105608183 AGAAGATTTACATCTCAAAGGGG - Intergenic
1073819715 10:107247526-107247548 AGAAGACTTACATCTCAAAAAGG + Intergenic
1073901041 10:108221387-108221409 AGAAGACTTATATGTCAAAAGGG + Intergenic
1073946542 10:108757262-108757284 AGAAGATTTCCAACTCAAAGTGG - Intergenic
1075138551 10:119809758-119809780 AAATTATTTACATCTCAAACTGG - Intronic
1075449471 10:122539612-122539634 AGACTATTTACCTCTGAAAGTGG - Intergenic
1077132818 11:982349-982371 TGTAGATTTAAATCTCAAAGAGG - Intronic
1077757669 11:5051831-5051853 AGAAGATTTACATCACCACAAGG - Intergenic
1079257565 11:18845501-18845523 AGAAGATTTTTAACTAAAAGAGG - Intergenic
1079389906 11:20013153-20013175 AGATGATCTACAACTCAGAGAGG - Intronic
1079611814 11:22442056-22442078 AGAAGATTTACATTTCTAAAAGG + Intergenic
1079675903 11:23226150-23226172 AAAAGATTTACATCTCAAATAGG + Intergenic
1079711713 11:23692291-23692313 AAAATATTTTCATCTCAAAGGGG - Intergenic
1079779023 11:24574852-24574874 AGAAAATTTATATCTTAAAAGGG + Intronic
1080480002 11:32637868-32637890 AGTAGATTAACATCTCCAAATGG + Intronic
1081200045 11:40204443-40204465 AAAAGATTTACATGTCAAAGGGG - Intronic
1081213858 11:40370048-40370070 AGAATACTTACATCTGCAAGAGG + Intronic
1081322338 11:41706356-41706378 TAAAGATTTACATCATAAAGAGG + Intergenic
1084071597 11:66740059-66740081 ATAAAATCTACATCACAAAGTGG - Intergenic
1085306078 11:75486841-75486863 AAAAGATTTGCAGCACAAAGGGG + Intronic
1087191083 11:95255327-95255349 AGAAAATATATATCTCAGAGAGG + Intergenic
1087415969 11:97855835-97855857 AGAAGATTTACATCTCAAAGGGG + Intergenic
1087954729 11:104271540-104271562 AAAAGATTTACATTTCAGAGAGG - Intergenic
1088171986 11:107008651-107008673 ACAGGATTTCCATCTCAAAGAGG + Intronic
1089328980 11:117676876-117676898 ACCAGATGTCCATCTCAAAGGGG + Intronic
1090315213 11:125780419-125780441 AAAAGATTAACAATTCAAAGGGG + Intergenic
1090563302 11:127957833-127957855 CGTATATTTACATCTCAAATAGG + Intergenic
1090759272 11:129821590-129821612 AGAAAAGTGACATCTCAAATGGG - Intronic
1091119719 11:133046803-133046825 TGAATATTTACATCTCCAAGAGG - Intronic
1091960748 12:4692060-4692082 GGAAGATGTATGTCTCAAAGGGG + Exonic
1092160266 12:6311928-6311950 AGAGGAGGTACATCTCCAAGGGG + Intronic
1092618927 12:10241575-10241597 AAAAGATTTACACCTCAAAGCGG + Intergenic
1092932513 12:13329729-13329751 AAAAGATATACAACTCCAAGAGG - Intergenic
1093163890 12:15782871-15782893 AGATGATTAACATCACACAGTGG - Intronic
1095072746 12:37875802-37875824 AGAATATACACATCACAAAGTGG + Intergenic
1095298945 12:40559800-40559822 AGAAGATTTACATCTTGAAGGGG + Intronic
1095411910 12:41933721-41933743 AGAAGATTTACATCTCTAAGGGG - Intergenic
1095548859 12:43408916-43408938 ATAACACTTACATCTCAAGGTGG + Intronic
1096421454 12:51461957-51461979 AGAAAATTTCCCTCTCAACGTGG + Intronic
1097591456 12:61580736-61580758 AACGTATTTACATCTCAAAGGGG - Intergenic
1098633083 12:72748427-72748449 GGAAGATTTGCATCTCAAAGGGG + Intergenic
1098710124 12:73747505-73747527 AGAAAGTTTGCATTTCAAAGGGG - Intergenic
1099567452 12:84270694-84270716 AAAAGATTTACATATCAAAGTGG + Intergenic
1099606260 12:84805557-84805579 AGAAAATTTGCATCTCAAAGGGG - Intergenic
1099718842 12:86335287-86335309 AGAAGATTTACATCTCAAAGGGG - Intronic
1099800021 12:87444957-87444979 AAAAGATTTGCATCTCAAAGTGG + Intergenic
1100217287 12:92465128-92465150 AGAATGTTTACATATCAAAGTGG - Intergenic
1101721491 12:107354148-107354170 AGAGGGTTTAGCTCTCAAAGAGG - Intronic
1103386941 12:120540367-120540389 TGAAGTTTTAAATCTCAGAGTGG - Intronic
1104161665 12:126186962-126186984 AAAAGATTTACATCTCAAAGGGG - Intergenic
1104285353 12:127419611-127419633 AAAAAATGTACATCTGAAAGGGG + Intergenic
1104340560 12:127944936-127944958 AGCAGATTTCCCTCTCCAAGGGG - Intergenic
1104601440 12:130156471-130156493 AGAAGATTTCCATTTCAGAGAGG - Intergenic
1105240290 13:18601737-18601759 AAAAGATTTATTTATCAAAGAGG - Intergenic
1107182355 13:37475419-37475441 AGAAGATTTACATGTCAAAAGGG + Intergenic
1107237120 13:38185138-38185160 AGAAACTTAACATCTCAAAAAGG + Intergenic
1107302674 13:38982385-38982407 AAAAGATTTAAATCTCAAAGAGG - Intronic
1108145539 13:47472701-47472723 AGATGATTTACATCTCAAAGGGG - Intergenic
1108495988 13:51025903-51025925 AGGAGATTTTCATATCAAAAAGG - Intergenic
1108735181 13:53276300-53276322 AGAAGATTTACATCTCAAAGAGG - Intergenic
1108822206 13:54367458-54367480 ACAACATTTACCTCTGAAAGAGG + Intergenic
1108823859 13:54387846-54387868 AGAAAATTTACACCTCAAAGGGG + Intergenic
1109093667 13:58082630-58082652 AGAAGGTGGACATCTCAAAGAGG - Intergenic
1109154137 13:58883648-58883670 AGATGATGTACGTCTCAAAGAGG + Intergenic
1109342472 13:61078615-61078637 AGAAAATTTACATCTCAAAAGGG - Intergenic
1109348636 13:61146632-61146654 AAAAAATGTACATCTCAAAGGGG + Intergenic
1109372200 13:61437362-61437384 AAAAGGTTTACATCTCAGAAGGG + Intergenic
1109388290 13:61662027-61662049 AGAAGATTTATGTCTCAATGGGG + Intergenic
1109427162 13:62179829-62179851 AAAAGCTTTACATCTTAAAGAGG + Intergenic
1109477808 13:62906739-62906761 AGAAGATTTATATCTTCAATGGG + Intergenic
1109523295 13:63541562-63541584 AGAAGATTTACATACGAAAGGGG + Intergenic
1109555341 13:63967124-63967146 AAATGGTTTACATTTCAAAGAGG + Intergenic
1109631142 13:65047955-65047977 AGAAGATTTACATTTCAAAGGGG + Intergenic
1109727975 13:66370163-66370185 AGAAGATTTACATCTCAAAGGGG - Intronic
1109888769 13:68579201-68579223 AGAAGATTTACATTTCAAAGGGG + Intergenic
1110140492 13:72123094-72123116 GGAAGATTTACATCTCAAAAGGG - Intergenic
1110432576 13:75442148-75442170 AAAAATGTTACATCTCAAAGAGG + Intronic
1110521105 13:76477870-76477892 GGGAGATTCACATCTTAAAGGGG + Intergenic
1110745730 13:79051121-79051143 AGAAGATTTACATCTCATAAAGG + Intergenic
1110928233 13:81182867-81182889 AAAAGATTTATATGTCAAAGAGG + Intergenic
1110977281 13:81855064-81855086 AGAAAATTGAAATCTCAAACCGG - Intergenic
1111151457 13:84259508-84259530 AAAAGATTTACATATCAAAGGGG - Intergenic
1111388006 13:87554560-87554582 AGACGATTTACATCTCAAAGTGG - Intergenic
1111737207 13:92157548-92157570 GGAAGATTTAAATCTCAAATGGG + Intronic
1111884457 13:94002137-94002159 AGAAGATTTACATCTCAAAGAGG + Intronic
1112437111 13:99398458-99398480 AGAAGATTTCTGTCTCATAGAGG - Intergenic
1112805566 13:103160996-103161018 AGAAGATTTACATTTCAAATTGG - Intergenic
1112829412 13:103430013-103430035 AGAAGATTTATATCTTAAAGAGG + Intergenic
1113284752 13:108834414-108834436 AGAAGATATACATCTCAAAGGGG + Intronic
1113715344 13:112501933-112501955 AGAAGGTTCACATCTGTAAGTGG + Intronic
1114591541 14:23869476-23869498 AAAATACTTACCTCTCAAAGGGG + Intergenic
1114595420 14:23908090-23908112 AGAGGTCTTAGATCTCAAAGGGG - Intergenic
1114811491 14:25905612-25905634 AGAAGAGTTACATCTCAAAGCGG - Intergenic
1114977610 14:28121756-28121778 TAAAGTTTTACATCTGAAAGGGG + Intergenic
1115732230 14:36283608-36283630 AGTAGATTTACAGCACAAAAGGG - Intergenic
1116045368 14:39736250-39736272 AGAAGATTTACTTCTCTAAGGGG + Intergenic
1116102701 14:40462359-40462381 AGAAGACTGACTTCACAAAGCGG + Intergenic
1116159349 14:41249249-41249271 AAAATATTTAAACCTCAAAGAGG - Intergenic
1116471891 14:45295219-45295241 AATACATTTACAACTCAAAGTGG - Intergenic
1116572908 14:46540497-46540519 AAAAGATTTATGTCTCAAAGGGG + Intergenic
1116911018 14:50464526-50464548 AGACTATTTAAATCCCAAAGAGG + Intronic
1117099291 14:52330076-52330098 AGAAGACCTGCATCACAAAGTGG + Intergenic
1117278159 14:54210412-54210434 AGAAGATTAACAACCCTAAGAGG + Intergenic
1120058379 14:79952674-79952696 AGAAGATTTAAATCTACCAGAGG + Intergenic
1120309020 14:82806693-82806715 GGTAGATTTCCATCTCAAAGGGG + Intergenic
1120652347 14:87150074-87150096 AGAAGATTTACATCTCAAAAGGG - Intergenic
1121390508 14:93569504-93569526 AGAAGATTTACATCTGAAAAGGG + Intronic
1122002372 14:98670220-98670242 AGGAAATTTACACCTCAAATGGG - Intergenic
1122245336 14:100398973-100398995 AGAAGATTTGCACCTTAATGAGG + Intronic
1122897506 14:104767614-104767636 AGGAGATGCACATCTCAGAGAGG - Intronic
1125000815 15:34768394-34768416 AGAAGATTGACAGGTGAAAGAGG + Intergenic
1125426461 15:39554064-39554086 TGAACATTTACAAATCAAAGGGG + Intergenic
1126240712 15:46439919-46439941 AGAAGCTTAACATGCCAAAGGGG + Intergenic
1127685026 15:61335090-61335112 AAAAGGTTTACATCTTAAAGGGG - Intergenic
1128846339 15:70899883-70899905 AGAAGATTTTCTTTTCATAGAGG + Intronic
1129803018 15:78430730-78430752 AAAGGACTTACATCTGAAAGTGG + Intergenic
1130784488 15:87081098-87081120 ACAAGATTTACATCTAAATTAGG + Intergenic
1131473412 15:92715548-92715570 CAAAAATTGACATCTCAAAGAGG + Intronic
1131727303 15:95240564-95240586 TGAAGATTTAAATATAAAAGAGG + Intergenic
1132200014 15:99945050-99945072 AGAATAATGACAACTCAAAGAGG + Intergenic
1137542487 16:49374427-49374449 GAGAGATTTACATCTCAAAGGGG + Intronic
1137750459 16:50857845-50857867 CGAATATTTACATCGCAAGGTGG - Intergenic
1138747079 16:59376043-59376065 AAAAAATGTACATCTCAGAGAGG - Intergenic
1138852937 16:60651952-60651974 AAATATTTTACATCTCAAAGGGG - Intergenic
1140548501 16:75836454-75836476 AGAAGATTTACATCTCAAAGAGG - Intergenic
1140556540 16:75927946-75927968 AAGAGATTTACATGTTAAAGAGG - Intergenic
1140617162 16:76679403-76679425 AAAAAATTCACATCTCAAAGGGG - Intergenic
1140756135 16:78068761-78068783 TGAACATTAACATCACAAAGAGG + Intergenic
1145405195 17:22584119-22584141 ACAAGATTTATATCTCAAAGGGG - Intergenic
1145772086 17:27500532-27500554 AGAACATGAACATCTCAATGAGG - Intronic
1148975557 17:51525182-51525204 AGAAGATTTCCATCATAAAGGGG + Intergenic
1149134225 17:53345464-53345486 AAAAGATGTACATCTCAAAGTGG + Intergenic
1149193977 17:54097483-54097505 AGAAAATTTATATCTCTAATGGG - Intergenic
1149216580 17:54361614-54361636 AGAAGATTTACATCTCAAAGGGG + Intergenic
1149224982 17:54459463-54459485 GGAAGATTTACATCTCAAAAGGG - Intergenic
1149513916 17:57265595-57265617 TGAACATTTACATCGCAAAGGGG - Intronic
1150673832 17:67226774-67226796 AGTAGTTTTATATCACAAAGAGG - Intronic
1151095614 17:71494266-71494288 AAAAGTTTTAAATCTCAAATGGG + Intergenic
1152043179 17:77918206-77918228 AGATTATTTACATCTCTAAAGGG + Intergenic
1153437649 18:5084965-5084987 TGAAGAGTTACATGTCAAATGGG - Intergenic
1154026057 18:10708102-10708124 AGAACAATTACATCTCACAGAGG + Intronic
1154405755 18:14089808-14089830 AGAAGATTTACAAATAAAATAGG - Intronic
1155779189 18:29809968-29809990 AGAAGATTTACATCTCCAAAGGG - Intergenic
1155807916 18:30195383-30195405 AAAAGATTTAAATCTCACAGAGG - Intergenic
1155814437 18:30287430-30287452 AGAATATTTATATCTCGAAGAGG - Intergenic
1156063039 18:33104058-33104080 ACAATATTTACAAATCAAAGGGG + Intronic
1156194488 18:34758693-34758715 AAGATATTTACATCTCAAAGGGG + Intronic
1156385172 18:36598166-36598188 ATAAATTTTACTTCTCAAAGTGG + Intronic
1157503800 18:48211344-48211366 AGAAGATTTTCATTTTAATGAGG - Intronic
1158091269 18:53716500-53716522 AAATGATTTGCATTTCAAAGGGG + Intergenic
1158380956 18:56929460-56929482 AAAAGATTTTCATCTCTAAAAGG - Intronic
1158640697 18:59201250-59201272 AGGAGATTTACATCTCAAAGTGG - Intergenic
1158782635 18:60669244-60669266 AAAAGATTTATATCTCAAAGGGG - Intergenic
1158792996 18:60804593-60804615 AAAGGATCTACATCTGAAAGGGG + Intergenic
1158796279 18:60849823-60849845 AGAAGATTTACATCTTAAATAGG - Intergenic
1159103050 18:63976553-63976575 AAAAGATTTACATCTCAAAGGGG + Intronic
1159213961 18:65365727-65365749 AAATGATTTACATCTCAAAAGGG + Intergenic
1159248204 18:65837592-65837614 AAAAGATTTACATATTAAAAGGG + Intronic
1159253061 18:65906900-65906922 AAATGATTTACATCTCAAAGAGG + Intergenic
1159442371 18:68497930-68497952 GGAAGATTTTCATCTCCAAGGGG - Intergenic
1159528578 18:69626843-69626865 AAAAGATTTCTGTCTCAAAGAGG + Intronic
1159588094 18:70301496-70301518 AGAAGATTTAAACCTGCAAGTGG + Intronic
1159843469 18:73427923-73427945 AAAAGATTTACAGCTCAAAGGGG - Intergenic
1159851849 18:73534522-73534544 AAAAGATTTACATCTTAAACAGG + Intergenic
1159900489 18:74040328-74040350 GGAAGCTTTACATCTCAAAGCGG - Intergenic
1160607209 18:80060173-80060195 AGAGCATTTACATCTTAAATAGG - Intronic
1165673039 19:37695712-37695734 GGTAGATTTGCATCTCAAAGGGG + Intronic
1166680780 19:44765308-44765330 AGAAGACCCACATCTCAAGGCGG + Intergenic
1167640222 19:50677534-50677556 AGAGAATTTACATTTGAAAGAGG - Intronic
1167681060 19:50921578-50921600 AGCAGATTTCCTTCTTAAAGGGG + Intergenic
1167745836 19:51351426-51351448 AGCAGATTCACAACTCAAACTGG - Intronic
1168441322 19:56369710-56369732 AATAGATTTTCTTCTCAAAGGGG + Intergenic
926514354 2:13822644-13822666 AAAAGATTTACATCTCAAAGGGG + Intergenic
927168226 2:20346585-20346607 AGAAGTTCTGGATCTCAAAGTGG - Intronic
927359689 2:22218292-22218314 ATAAAATTTACAACTCTAAGGGG - Intergenic
927409051 2:22804664-22804686 AGAAGATTTACATCTCAAAGGGG + Intergenic
928790746 2:34949547-34949569 AACAGATTTACATCTCAAAGCGG + Intergenic
929074537 2:38068760-38068782 AGCAGAGTTAAATCTCAAATAGG - Exonic
929406240 2:41645438-41645460 AAAAAATTTACATCTCTAATTGG + Intergenic
930458083 2:51632196-51632218 AAAAGATTTAATTCTCAAAGCGG + Intergenic
930519059 2:52440291-52440313 AGAAGATTTACATCTCAAAGGGG - Intergenic
930603915 2:53472882-53472904 AAAACATTTACATCTCAAAGGGG - Intergenic
930896311 2:56450687-56450709 TGAAGATTTACATCTCAAAGGGG - Intergenic
930968869 2:57369301-57369323 AGAAGATTTACATCTCAAAGAGG - Intergenic
932707664 2:74039103-74039125 AGCAGATTTACATCTCAGGAGGG - Intronic
933029930 2:77315704-77315726 AAAATATTTACTTCTCAAAAGGG - Intronic
933137572 2:78757433-78757455 AAAATGTTTACATCTCAAAGGGG + Intergenic
933139061 2:78770762-78770784 AAAAGATTTATATCACTAAGGGG + Intergenic
933514580 2:83284233-83284255 AAAAGATTTACATCCCTAAAGGG - Intergenic
933736656 2:85500762-85500784 AGAATATTTTCTTCTTAAAGGGG - Intergenic
937214674 2:120304123-120304145 AGAAACTTTATATTTCAAAGAGG + Intergenic
937278475 2:120701631-120701653 ATAAGATTTCCATCTGAATGAGG - Intergenic
937751610 2:125481557-125481579 AGTATATTGACATCTCAAGGTGG + Intergenic
937879525 2:126854977-126854999 TGAAGATTTAGAACTCAAAGTGG - Intergenic
939341784 2:140905440-140905462 AGAAGATTTACACCTCAAAAAGG - Intronic
939957920 2:148542023-148542045 AAAGGCTTGACATCTCAAAGAGG + Intergenic
940298574 2:152155792-152155814 TAAAGATTTACATGTGAAAGGGG - Intronic
940550021 2:155141898-155141920 AAAGGATTTGCATCTCAAATGGG + Intergenic
941151253 2:161918457-161918479 AGAAGTTTTAAATTTCAAATAGG + Intronic
942153059 2:173097733-173097755 AGAAGATCAACATGTCAAACTGG + Intronic
943205695 2:184891786-184891808 ACAATATTTACATTTTAAAGAGG + Intronic
943235823 2:185318324-185318346 AAAGCATTTACATCTCAAAGAGG - Intergenic
943311436 2:186329924-186329946 CAAAGCTTTACAGCTCAAAGGGG - Intergenic
943355702 2:186852551-186852573 AGAATATTTACATCTTAAAGGGG - Intergenic
943462472 2:188185532-188185554 AAAGGATTTACTTCTCAAAAGGG + Intergenic
943917825 2:193660419-193660441 AAAAGATTTACATTTCAAAGAGG - Intergenic
944013707 2:195006177-195006199 AGAGGATTTATATCTGAATGCGG - Intergenic
944939757 2:204610676-204610698 AGTAGACTAACATATCAAAGTGG - Intronic
945560406 2:211331975-211331997 TCAAAATTAACATCTCAAAGGGG + Intergenic
946518658 2:220442012-220442034 AGAGGGTTTAGCTCTCAAAGAGG - Intergenic
947243668 2:228022624-228022646 AAAGGATTTACATCTCAAAAAGG + Intronic
947270742 2:228331747-228331769 AGAAAATATAAATGTCAAAGAGG - Intergenic
947288698 2:228547034-228547056 TAAAAATGTACATCTCAAAGGGG - Intergenic
947892652 2:233639343-233639365 AGAGGAATTCGATCTCAAAGAGG + Intronic
949073584 2:242041148-242041170 AGAAGATTTACACCTGGAAGAGG - Intergenic
1169680020 20:8201619-8201641 AGAAGCTTTCCATCTCATATAGG + Intronic
1171081113 20:22185765-22185787 AAAAAATTTACATCAAAAAGTGG - Intergenic
1171453261 20:25250914-25250936 AAAATATTTACAGCACAAAGTGG - Intronic
1173474169 20:43347077-43347099 GGGAGATTTACATCTCAAAAGGG - Intergenic
1173546190 20:43899928-43899950 AGGTAATTAACATCTCAAAGTGG - Intergenic
1174247814 20:49195142-49195164 AAAAAATTTGCATCTCAGAGAGG + Intergenic
1175396153 20:58663569-58663591 AGAGGAACTACATATCAAAGAGG + Intronic
1175621327 20:60450061-60450083 AAAATATTTACATCTCAATGGGG - Intergenic
1175648891 20:60699463-60699485 AGAAGATTTGTATCTCACATGGG + Intergenic
1176383162 21:6123839-6123861 AGAAGTTTCAAATCTTAAAGAGG + Intergenic
1176447692 21:6833478-6833500 AAAAGATTTATATATCAAAGAGG - Intergenic
1176825861 21:13698504-13698526 AAAAGATTTATATATCAAAGAGG - Intergenic
1177190683 21:17847911-17847933 AGAAGATCTACATCGCAAAGGGG - Intergenic
1177285968 21:19050175-19050197 AGAAAATTTATATCTCAAAGGGG + Intergenic
1177304232 21:19292053-19292075 AGAAGATTTGTGTCTTAAAGGGG - Intergenic
1177434543 21:21033974-21033996 GGAAGTTTTACATATTAAAGTGG + Intronic
1177531124 21:22359750-22359772 AGAAAATTTGCATCTCAAAGGGG - Intergenic
1178087433 21:29126094-29126116 AGAAGAGTTACTTCTCCCAGAGG + Intronic
1179271191 21:39852369-39852391 AGAAGATTTACATCTCAAATGGG - Intergenic
1179740305 21:43414400-43414422 AGAAGTTTCAAATCTTAAAGAGG - Intergenic
1179843359 21:44092261-44092283 AGAAGAATTAAATCTGAAACTGG + Intronic
1182922648 22:34094460-34094482 AAAAGATTTACATCTCAAAGGGG - Intergenic
1184923261 22:47620461-47620483 ACAAGATCTACACCTCTAAGAGG - Intergenic
1185202961 22:49519481-49519503 AGAAGATTCACAGCTGGAAGCGG + Intronic
949256399 3:2051637-2051659 AGAAGATTCATATATCAAAGGGG + Intergenic
951723462 3:25726947-25726969 AGATTCTTTACCTCTCAAAGAGG - Intronic
952470202 3:33640035-33640057 AGAAGATTTTCACCTTAAAGGGG - Intronic
952559159 3:34569448-34569470 AGAAGTTGTACATCTTAAAGAGG - Intergenic
953378508 3:42448644-42448666 GGAAGATCTACATTTTAAAGGGG - Intergenic
954846192 3:53559710-53559732 AAGAGAGTTACATCACAAAGGGG - Intronic
955662365 3:61314879-61314901 AGAAGGTTTACCTCCCAAAGTGG - Intergenic
956314966 3:67924897-67924919 AGCAGATAAACATTTCAAAGAGG + Intergenic
956404645 3:68915545-68915567 AGAAAATTTAACTCTCAAAATGG + Intronic
956707642 3:72013045-72013067 AGAATTTTTACATCTCAATCCGG - Intergenic
957196123 3:77070778-77070800 ACTTGATTTACATTTCAAAGAGG + Intronic
957892784 3:86381474-86381496 ACAGGATTTACATCTCTAAGAGG + Intergenic
958847850 3:99286810-99286832 GGAAGATATACATTTAAAAGAGG + Intergenic
958858482 3:99416505-99416527 AGAACATTTACATCACAACAGGG - Intergenic
960392639 3:117097613-117097635 TGAGAATTTATATCTCAAAGGGG - Intronic
961801736 3:129455968-129455990 AGAAAATTCACATGTAAAAGTGG + Intronic
962503248 3:136017636-136017658 AAAAAAGTTACATATCAAAGTGG - Intronic
963463195 3:145643833-145643855 TGAAGACTTCCATTTCAAAGTGG - Intergenic
963672888 3:148274138-148274160 TGAAGATTTACAACTCAAAGGGG - Intergenic
963721324 3:148865364-148865386 GTAAGATTTACCTGTCAAAGCGG - Exonic
964091622 3:152883812-152883834 GGAAGATATTCCTCTCAAAGAGG + Intergenic
965128525 3:164663030-164663052 CAAAGTTTTACATCTCATAGGGG - Intergenic
970559200 4:17266416-17266438 TGAGGACTTACAGCTCAAAGAGG + Intergenic
970785873 4:19795264-19795286 AGAAAATTTACAGATCTAAGAGG - Intergenic
970809315 4:20073050-20073072 AGATGATTTACATTTTACAGAGG + Intergenic
971528385 4:27652167-27652189 AGAAGATGTGCATCACAAAGGGG + Intergenic
971653070 4:29304469-29304491 AAAAGATTTACATTTTAAAGGGG + Intergenic
971952025 4:33363805-33363827 AGATGATTTACATATACAAGAGG + Intergenic
971963710 4:33523473-33523495 TGAAGATCTAAATCTCAAAGAGG - Intergenic
971998396 4:33996235-33996257 ACAAGATTTACATCTCAAAGGGG + Intergenic
972008610 4:34144596-34144618 AACATATTTATATCTCAAAGAGG - Intergenic
972034967 4:34508400-34508422 AGATGATTTACATCTCAAAGAGG + Intergenic
972935422 4:44128773-44128795 AAAAGATTTACATCTCAAAAGGG + Intergenic
973198497 4:47473434-47473456 GAAAGATTTATATTTCAAAGGGG + Intergenic
974145879 4:57946520-57946542 AAAAGATTTACATCTCTAATGGG + Intergenic
975083035 4:70303396-70303418 AAAAGAATTACATCTCAAAGGGG - Intergenic
976123932 4:81813159-81813181 ACAATAATTACAGCTCAAAGAGG + Intronic
976473730 4:85458854-85458876 AGAATATGTACATGTCAAGGAGG + Intergenic
977645212 4:99404130-99404152 AGGAGATTTCCATCTCGAAAAGG - Intergenic
978367128 4:107994179-107994201 AGAAAGTTTGCATCTTAAAGGGG + Intronic
979974567 4:127181084-127181106 GGAGTATTTACATCTCAAAGGGG + Intergenic
980226770 4:129997642-129997664 AGGAAATTTGCATTTCAAAGAGG + Intergenic
980256484 4:130386590-130386612 AGAAGCTTTACATCTCATAGAGG + Intergenic
980487286 4:133474750-133474772 GGGAGATTTACATCTCAAAGAGG + Intergenic
981243576 4:142508042-142508064 AGAAGATCTATATCTCAAAGTGG - Intronic
981398133 4:144278659-144278681 TGAAGATTTTCCTCTCAAAGAGG - Intergenic
982430800 4:155319816-155319838 AGAAGATTTACATTTCAAAAGGG + Intergenic
982834068 4:160100923-160100945 AGAACATTTGCATCACAAGGAGG + Intergenic
982854536 4:160364129-160364151 AAAAGATTAACATCTCAAAAAGG - Intergenic
982913879 4:161180540-161180562 AGGAAATTCACATCTCAAAAAGG - Intergenic
982949500 4:161672288-161672310 TGAAGATTTATATGTTAAAGGGG - Intronic
983410437 4:167389575-167389597 TCAAGATTTACATTTCAAAGGGG - Intergenic
983456063 4:167966553-167966575 AGAATATATTCATCTCATAGGGG - Intergenic
983469124 4:168135399-168135421 AGGAGACTTACATCTCTAAGAGG + Intronic
986070797 5:4280483-4280505 ACACGATTGACATGTCAAAGTGG + Intergenic
986376520 5:7137505-7137527 TGAAGATTTACATCTCAAAGGGG + Intergenic
986922496 5:12704645-12704667 AAAAGATTTACATCTCAAATGGG - Intergenic
987973030 5:24975647-24975669 AAAAGATTTACATCTCCAAGGGG + Intergenic
988024525 5:25668128-25668150 AAAAGATTTATGTCTCAAAGGGG + Intergenic
988176080 5:27727427-27727449 AGAAGATTTACATCTCAAAGGGG - Intergenic
992349977 5:75918782-75918804 AGAAGAGTTACACCACAGAGTGG + Intergenic
992849654 5:80794139-80794161 GATAGATTTACATCACAAAGGGG + Intronic
993573221 5:89568623-89568645 AGAAGATTTATACCTAAAAAGGG - Intergenic
994047643 5:95327684-95327706 TAAAAATTCACATCTCAAAGGGG + Intergenic
994422622 5:99540002-99540024 AAAAGATTTACATCTCAAATGGG + Intergenic
994459749 5:100057501-100057523 AAAAGATTTACATCTCAAATGGG - Intergenic
994497666 5:100534548-100534570 AAAATATTTACATCTGAAAAGGG + Intergenic
994502218 5:100593407-100593429 AAAATATTTACATCTGAAATGGG + Intergenic
994824405 5:104695031-104695053 AAATGATTTACATCTTAAAGGGG + Intergenic
994914592 5:105958062-105958084 AGAAGCTTTACAGTTCAAAAAGG + Intergenic
994989171 5:106977519-106977541 AGTACATTTACAACTCAACGGGG - Intergenic
995274414 5:110262001-110262023 ATATTACTTACATCTCAAAGTGG - Intergenic
995381200 5:111535314-111535336 AAAAGATTTATATCTCAAAGGGG + Intergenic
995616293 5:113967955-113967977 AGCAGGTTTACATCACTAAGGGG - Intergenic
995958151 5:117805301-117805323 AGAAGATTAACATCTTAAAGAGG + Intergenic
995966243 5:117911110-117911132 GGAAGATTTACAGTTCAAAAGGG - Intergenic
996138679 5:119877258-119877280 AGAAGAATTAGATCCAAAAGAGG - Intergenic
996214616 5:120851595-120851617 AGAAAATGCACATCACAAAGGGG - Intergenic
997034164 5:130167433-130167455 GGAAGATTTACATCTCAATAGGG + Intronic
997043578 5:130286529-130286551 GGGAGATGTACATCTCAAAAGGG + Intergenic
997073687 5:130646543-130646565 AAAAGATTTACATCTCAAAGAGG + Intergenic
997088754 5:130831609-130831631 AGAAGATATAAATTTCAAAGGGG + Intergenic
998432963 5:142082372-142082394 AACATATTTACATCTTAAAGGGG + Intergenic
998726843 5:145027227-145027249 AAAAGATTTGCATCTCAAAGGGG + Intergenic
999138300 5:149338722-149338744 AGAAGATGAACGTCCCAAAGGGG + Intronic
999934971 5:156476575-156476597 AGAAGAATTATATCTGAAACTGG + Intronic
1000587080 5:163113409-163113431 AAAAGATTTACATCTTAAAGGGG + Intergenic
1000766470 5:165297204-165297226 AGAAGATACACTTCTCAAAAGGG + Intergenic
1000828432 5:166074600-166074622 AGAAGATTTACATCTCAAAAGGG + Intergenic
1000940326 5:167352996-167353018 AAGAGATTTGTATCTCAAAGCGG + Intronic
1002846560 6:950978-951000 AGAAGACTTACCTCTCAAGCTGG - Intergenic
1004169803 6:13287159-13287181 AGAAGATTTACATCGTAATGGGG - Exonic
1005123314 6:22415760-22415782 GGAAGCTATTCATCTCAAAGTGG + Intergenic
1008248623 6:49209053-49209075 AGAAGATTTATATCACAAAGAGG - Intergenic
1008277389 6:49557565-49557587 CTTAGATTTACATTTCAAAGGGG - Intronic
1008316937 6:50055304-50055326 AAAAGATTTATATCTCAAAGAGG - Intergenic
1008844032 6:55939879-55939901 AGATGATTTTCTTCCCAAAGTGG - Intergenic
1009266885 6:61567201-61567223 GGAAGATTTATATCTCAAAGGGG + Intergenic
1009335112 6:62478191-62478213 AAAATATTCACATCTCAAAGTGG - Intergenic
1009399435 6:63236971-63236993 AAAAGATTTACATCTCAAAGGGG + Intergenic
1009682970 6:66922849-66922871 AGAAGATTTACATCTCAAAGGGG - Intergenic
1010087804 6:71940895-71940917 AGAAGATTTATGTCTCAAAAGGG + Intronic
1010483798 6:76385020-76385042 AGAAGATTTATATATCAAAGAGG - Intergenic
1010486708 6:76423026-76423048 AGAAGATTTACATCTCAAAGAGG + Intergenic
1011388444 6:86823145-86823167 AGAAGATTTACTTATCAAAGGGG + Intergenic
1012050545 6:94337223-94337245 AGCAGCTTTATATCTGAAAGAGG - Intergenic
1012115001 6:95285707-95285729 AGAAAATTTGCATCTCAAAAGGG - Intergenic
1012264579 6:97125921-97125943 AAATGATTTACATCTCAAAGAGG + Intronic
1012354600 6:98298152-98298174 GGAAAAATCACATCTCAAAGTGG + Intergenic
1012599996 6:101083946-101083968 TGTAGATTTACATCTCAATGGGG - Intergenic
1012773083 6:103465904-103465926 AGAAGATTTATATATCAGATAGG + Intergenic
1012857226 6:104516857-104516879 AGAAGAATTGCACATCAAAGGGG - Intergenic
1013415747 6:109922850-109922872 AGCAGATTTACATCTCAGTCTGG + Intergenic
1013814677 6:114083528-114083550 AGAAGATTTACATCTCAAACAGG + Intronic
1013906068 6:115221414-115221436 AAAAGATTTACATCACAAAAGGG + Intergenic
1013927123 6:115486699-115486721 AGAAGATTTATATCTGAAAGAGG + Intergenic
1014016377 6:116535204-116535226 AGAAGAATGACAGCTGAAAGAGG + Intronic
1015558792 6:134492390-134492412 AGAGGATATATATCTCCAAGTGG + Intergenic
1015667912 6:135652297-135652319 GGAGGATTTACATCTCATAGGGG - Intergenic
1016225397 6:141729303-141729325 AGAAGATTCACAACTTAAAGAGG - Intergenic
1016636943 6:146303473-146303495 AGACGATCTACATCTCAAAAAGG - Intronic
1016817906 6:148320532-148320554 TGAAGATTACCATCCCAAAGAGG + Intronic
1016849227 6:148600229-148600251 AGAAGATTTACATCTCAAAGGGG + Intergenic
1017263750 6:152418193-152418215 AGAAGAGTTACATCTCAAAGGGG - Intronic
1019149705 6:169997132-169997154 AGAAGAGTCACATCCCAGAGAGG + Intergenic
1019265865 7:117312-117334 AGAAGAGTTATTTCTCAAACTGG - Intergenic
1020408937 7:7868746-7868768 AGAAGATTTCTATCTCCATGTGG - Intronic
1020563494 7:9766331-9766353 AGAAGATTTGCATCTCAAAGAGG - Intergenic
1020590824 7:10134527-10134549 ATCAAATTTACATTTCAAAGTGG + Intergenic
1020638055 7:10720331-10720353 AGAAGATTTACAACTCAAACAGG + Intergenic
1021062486 7:16131131-16131153 AGAAAATTGGCATCACAAAGTGG + Intronic
1021134074 7:16944470-16944492 TGTAGATTTACATCTCAGAAAGG - Intergenic
1021391828 7:20102432-20102454 AGAAGATTTATATGAAAAAGTGG + Intergenic
1022368066 7:29744713-29744735 AGAAGTTTTACACATCAAACAGG - Intergenic
1022624048 7:32015656-32015678 AGAAGATTTAAATTTCCAAGTGG - Intronic
1023472330 7:40537210-40537232 GCAAGTTTTACTTCTCAAAGGGG - Intronic
1023526494 7:41108837-41108859 AGAATATTTATATCCCAATGGGG - Intergenic
1023732404 7:43204968-43204990 AGAAGGTTTCTATCTCAAACGGG + Intronic
1024741449 7:52359597-52359619 AGAAGATTTATATCTCCAAGGGG - Intergenic
1026371092 7:69700168-69700190 AGAAAATTGGTATCTCAAAGTGG + Intronic
1027456494 7:78398585-78398607 AGAAGATTTATATCTCAAAAGGG - Intronic
1027608160 7:80325892-80325914 TGAAGACTTACATATCAAAAAGG - Intergenic
1027975148 7:85144257-85144279 ATAAAATTTACAACTAAAAGAGG + Intronic
1028258834 7:88635376-88635398 GAAAGATTTACATCTCAAAGGGG + Intergenic
1028308887 7:89304093-89304115 AGAATGTTTACATTTCAAAGAGG - Intronic
1028358295 7:89936278-89936300 AAAATATGTACATCTCAAAGGGG + Intergenic
1030389269 7:108905645-108905667 AAAAAAATTACATCTTAAAGGGG + Intergenic
1030447540 7:109666470-109666492 AATAGATTTACATCTCAAATGGG - Intergenic
1030519038 7:110574194-110574216 AGAAGATTTACATCTCAAACTGG + Intergenic
1030903457 7:115152561-115152583 AGAAGATTTACATTTCAAAAGGG - Intergenic
1031299479 7:120046462-120046484 GAAAGATTTACATCTCAAAGAGG - Intergenic
1031458105 7:122009815-122009837 GGAAGATTTAGAACTAAAAGAGG - Intronic
1031570564 7:123354088-123354110 AGACAATTTACATCTCAAAGGGG + Intergenic
1031648936 7:124261822-124261844 ACAAGATTTACATCTCAAGGAGG - Intergenic
1032425477 7:131819200-131819222 AGAAGATTTACCTCTCAAAGGGG + Intergenic
1034002978 7:147436926-147436948 AAAAGGTTTACATCTCAATCGGG + Intronic
1034068052 7:148155674-148155696 AAAAAATTTATATCTCAAAAGGG + Intronic
1034074007 7:148214406-148214428 AGAAGATTTCCATCTAGCAGTGG - Intronic
1034720636 7:153289558-153289580 AAAAGATTCACATCTCAAAAGGG + Intergenic
1035138041 7:156727041-156727063 ATAAGTTTTACATATCACAGGGG - Intronic
1035980428 8:4364238-4364260 AAATGCTTTACATCTCAAAGGGG + Intronic
1036126062 8:6063449-6063471 AAATAATTTACGTCTCAAAGGGG - Intergenic
1036157661 8:6357522-6357544 AGAATATTCACATCCCATAGCGG + Intergenic
1036582170 8:10085298-10085320 AGATGATGTTCATCTCAAATGGG - Intronic
1037018055 8:13933053-13933075 AAAAGATTTACACCTCAAAAGGG - Intergenic
1037059461 8:14488495-14488517 GGATGATTTACATCTCAAAGGGG - Intronic
1042060975 8:64817390-64817412 AGAAGATATACATCTTTAAAAGG + Intergenic
1042485077 8:69339129-69339151 AGAAGATTTACACCTTGAAGGGG - Intergenic
1043247866 8:78028558-78028580 AGAAGATTTACATTCCAAAGGGG + Intergenic
1043341504 8:79245557-79245579 AAAAGATTTACATATCAAAGGGG - Intergenic
1043822162 8:84880216-84880238 AGAAAATTTGCCTCTCAAATGGG + Intronic
1043823829 8:84901157-84901179 GGAAGATTTATATCTCCAAGGGG + Intronic
1043928977 8:86069270-86069292 AGAAGATTTACATCTCAAAAGGG + Intronic
1044079339 8:87864629-87864651 GAAACATTTACATCTCAAAGGGG + Intergenic
1044118658 8:88366432-88366454 AGAGGATTTATATCTTAAAGGGG + Intergenic
1044294519 8:90511805-90511827 AAAAGATTTATATCTCAAAGGGG - Intergenic
1044297534 8:90546033-90546055 GAGAGATTTATATCTCAAAGGGG + Intergenic
1044964830 8:97564795-97564817 AGAAGATTTACAAAGCACAGTGG - Intergenic
1045822462 8:106356268-106356290 ACAAGATTTGCATCTCAAAGGGG + Intronic
1046205633 8:110992500-110992522 ATAAGATGTACATCTTAAAGGGG - Intergenic
1046254601 8:111679955-111679977 AAAAGATTTGTGTCTCAAAGGGG + Intergenic
1046396387 8:113645896-113645918 TAAAGATTTACATCTCATAGAGG - Intergenic
1048160768 8:132018996-132019018 AGAAGATTTATATCTCAAAGGGG - Intergenic
1048807806 8:138256717-138256739 AGTAGATTTTCAACTCAAGGTGG - Exonic
1049325741 8:142020612-142020634 AGGGAATTTGCATCTCAAAGAGG - Intergenic
1050795803 9:9539989-9540011 GGAAGAATTTCATCTCAAAATGG - Intronic
1050844962 9:10204149-10204171 AGAACATTCAAATCTCATAGAGG - Intronic
1051008005 9:12372268-12372290 CAAAGATTTATATCTCAAAGGGG + Intergenic
1051872294 9:21752319-21752341 AAAATATTTACATCTCAAAGGGG + Intergenic
1052030286 9:23620868-23620890 AGAAGACTTACATCTTGAAAGGG + Intergenic
1052136164 9:24913013-24913035 AGAAGATGTACATTGCAAAGGGG + Intergenic
1052221319 9:26026699-26026721 AAAAAATTTACATCTCAAAGGGG + Intergenic
1052276386 9:26681301-26681323 TGTAGATTTACATCTCAAAAGGG + Intergenic
1052388164 9:27846783-27846805 AGAAGATTTACACCTCAAAGGGG - Intergenic
1052503751 9:29326092-29326114 ACAAGATTTACATCTCAAAGGGG - Intergenic
1052576264 9:30295513-30295535 AGAAGATTTACATGTCAGTGGGG - Intergenic
1052722731 9:32191890-32191912 AAAATATTTACATCTTAAAAAGG - Intergenic
1056187264 9:84147613-84147635 AGCAGATTTACATTTCAACAGGG + Intergenic
1058249329 9:102671451-102671473 AGAAGATTTTCGTTTAAAAGGGG - Intergenic
1059702349 9:116787334-116787356 AAAAGATTTATGTCTTAAAGGGG - Intronic
1059914808 9:119086856-119086878 AGAAGATTTACATCCCAAAGGGG + Intergenic
1060710389 9:125857985-125858007 AGAATATTTTCACCTAAAAGAGG + Intronic
1203521499 Un_GL000213v1:51053-51075 AAAAGATTTATATATCAAAGAGG + Intergenic
1185674243 X:1835866-1835888 ATCAAATTTACATCTCCAAGAGG - Intergenic
1185890979 X:3821856-3821878 AGAAGATTTGCCTCTCAAAGAGG - Intronic
1186365190 X:8885371-8885393 ACAAGATTTAAATCTCAAAGGGG - Intergenic
1187025231 X:15428502-15428524 AGAAGAAATGCATCACAAAGAGG + Intronic
1188269932 X:28126986-28127008 AATATATTTGCATCTCAAAGAGG - Intergenic
1188358732 X:29225839-29225861 AGAAGGTTTACATCTGAAAGGGG + Intronic
1188376248 X:29432262-29432284 AGAAGATTTACACCTTAAAGGGG - Intronic
1188647086 X:32582836-32582858 AGAAGATTTACATCTCAAAGAGG - Intronic
1188968677 X:36585708-36585730 GAAAGATTCATATCTCAAAGGGG + Intergenic
1189635174 X:43000020-43000042 AGAAGGTTTAAATTTCTAAGGGG - Intergenic
1190495634 X:51025996-51026018 AGAAGATTTTCATCTTACTGGGG + Intergenic
1191607291 X:63076683-63076705 AAAAGCTTAACATCTCAAATTGG - Intergenic
1192607261 X:72531229-72531251 AGAAAATTTGCACTTCAAAGAGG + Intronic
1193540149 X:82761318-82761340 AGAAAATTTACAGCACATAGTGG + Intergenic
1194314005 X:92351012-92351034 AGATGATTTTCAATTCAAAGTGG + Intronic
1194314153 X:92353271-92353293 AGATGATTTTCAATTCAAAGTGG + Intronic
1194685637 X:96910795-96910817 AGAGAATTTACATGCCAAAGGGG + Intronic
1195581196 X:106504662-106504684 GGGAAATTTACATCTCAAAGTGG - Intergenic
1196393093 X:115230380-115230402 AGGAGATTAACATTTAAAAGGGG - Intronic
1197309479 X:124886617-124886639 ATAAGATTTACATTTTTAAGTGG - Intronic
1199233346 X:145464420-145464442 AGAAGAGTTGCATCTCCAACAGG + Intergenic
1199502602 X:148524634-148524656 AGAATATTCCCATCTTAAAGAGG + Intronic
1199712908 X:150484360-150484382 AGAATAATTACATCACAAGGAGG + Intronic
1200622274 Y:5465113-5465135 AGATGATTTTCAATTCAAAGTGG + Intronic
1201574715 Y:15450403-15450425 GCAAGATTTACAACTCACAGAGG + Intergenic
1201894288 Y:18977095-18977117 AGAAGATTTGCATCACAAATAGG + Intergenic