ID: 927411163

View in Genome Browser
Species Human (GRCh38)
Location 2:22828032-22828054
Sequence CTTCACAAGCAGCAAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927411160_927411163 23 Left 927411160 2:22827986-22828008 CCACAGGTCTTGAGAGATGGGAA No data
Right 927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG No data
927411159_927411163 24 Left 927411159 2:22827985-22828007 CCCACAGGTCTTGAGAGATGGGA No data
Right 927411163 2:22828032-22828054 CTTCACAAGCAGCAAATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927411163 Original CRISPR CTTCACAAGCAGCAAATGGA AGG Intergenic
No off target data available for this crispr