ID: 927411163 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:22828032-22828054 |
Sequence | CTTCACAAGCAGCAAATGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
927411160_927411163 | 23 | Left | 927411160 | 2:22827986-22828008 | CCACAGGTCTTGAGAGATGGGAA | No data | ||
Right | 927411163 | 2:22828032-22828054 | CTTCACAAGCAGCAAATGGAAGG | No data | ||||
927411159_927411163 | 24 | Left | 927411159 | 2:22827985-22828007 | CCCACAGGTCTTGAGAGATGGGA | No data | ||
Right | 927411163 | 2:22828032-22828054 | CTTCACAAGCAGCAAATGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
927411163 | Original CRISPR | CTTCACAAGCAGCAAATGGA AGG | Intergenic | ||
No off target data available for this crispr |