ID: 927412077

View in Genome Browser
Species Human (GRCh38)
Location 2:22838006-22838028
Sequence GGAAAACCCCATAATAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927412073_927412077 1 Left 927412073 2:22837982-22838004 CCTTGCACAAAGACTCATAAAAG No data
Right 927412077 2:22838006-22838028 GGAAAACCCCATAATAGGAAGGG No data
927412072_927412077 12 Left 927412072 2:22837971-22837993 CCATAATGAGGCCTTGCACAAAG No data
Right 927412077 2:22838006-22838028 GGAAAACCCCATAATAGGAAGGG No data
927412070_927412077 23 Left 927412070 2:22837960-22837982 CCCTTTAAATTCCATAATGAGGC No data
Right 927412077 2:22838006-22838028 GGAAAACCCCATAATAGGAAGGG No data
927412071_927412077 22 Left 927412071 2:22837961-22837983 CCTTTAAATTCCATAATGAGGCC No data
Right 927412077 2:22838006-22838028 GGAAAACCCCATAATAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927412077 Original CRISPR GGAAAACCCCATAATAGGAA GGG Intergenic
No off target data available for this crispr