ID: 927412897

View in Genome Browser
Species Human (GRCh38)
Location 2:22846789-22846811
Sequence TATGAAGCCAAGTGTATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927412897_927412905 26 Left 927412897 2:22846789-22846811 CCCCAAATACACTTGGCTTCATA No data
Right 927412905 2:22846838-22846860 AAGAGGAGCATGGTTGTTTGTGG No data
927412897_927412904 16 Left 927412897 2:22846789-22846811 CCCCAAATACACTTGGCTTCATA No data
Right 927412904 2:22846828-22846850 ATGAGGGCTGAAGAGGAGCATGG No data
927412897_927412900 -1 Left 927412897 2:22846789-22846811 CCCCAAATACACTTGGCTTCATA No data
Right 927412900 2:22846811-22846833 ATTCATTGACCTGTTTCATGAGG No data
927412897_927412903 9 Left 927412897 2:22846789-22846811 CCCCAAATACACTTGGCTTCATA No data
Right 927412903 2:22846821-22846843 CTGTTTCATGAGGGCTGAAGAGG No data
927412897_927412901 0 Left 927412897 2:22846789-22846811 CCCCAAATACACTTGGCTTCATA No data
Right 927412901 2:22846812-22846834 TTCATTGACCTGTTTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927412897 Original CRISPR TATGAAGCCAAGTGTATTTG GGG (reversed) Intergenic
No off target data available for this crispr