ID: 927417754

View in Genome Browser
Species Human (GRCh38)
Location 2:22896583-22896605
Sequence GGATAAACATAATTTAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927417754_927417756 -1 Left 927417754 2:22896583-22896605 CCTAGCTTAAATTATGTTTATCC No data
Right 927417756 2:22896605-22896627 CAAAATCTTTGCTTGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927417754 Original CRISPR GGATAAACATAATTTAAGCT AGG (reversed) Intergenic
No off target data available for this crispr