ID: 927429394

View in Genome Browser
Species Human (GRCh38)
Location 2:23014187-23014209
Sequence GGCCATGATGCACAGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927429394_927429400 23 Left 927429394 2:23014187-23014209 CCCTGTGTCTGTGCATCATGGCC No data
Right 927429400 2:23014233-23014255 TTTTAAAAGCCCTACCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927429394 Original CRISPR GGCCATGATGCACAGACACA GGG (reversed) Intergenic
No off target data available for this crispr