ID: 927430330

View in Genome Browser
Species Human (GRCh38)
Location 2:23021902-23021924
Sequence CTCTCTGTGCAGACTTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927430330_927430337 -3 Left 927430330 2:23021902-23021924 CCCACCTAAGTCTGCACAGAGAG No data
Right 927430337 2:23021922-23021944 GAGGGTGGGAAAGCCAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927430330 Original CRISPR CTCTCTGTGCAGACTTAGGT GGG (reversed) Intergenic
No off target data available for this crispr