ID: 927436218

View in Genome Browser
Species Human (GRCh38)
Location 2:23068805-23068827
Sequence CAGGATAATAATACAGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927436218_927436223 15 Left 927436218 2:23068805-23068827 CCAAGAACTGTATTATTATCCTG No data
Right 927436223 2:23068843-23068865 CGGCAGAGTTGACCATCCTGAGG No data
927436218_927436224 19 Left 927436218 2:23068805-23068827 CCAAGAACTGTATTATTATCCTG No data
Right 927436224 2:23068847-23068869 AGAGTTGACCATCCTGAGGATGG No data
927436218_927436219 -5 Left 927436218 2:23068805-23068827 CCAAGAACTGTATTATTATCCTG No data
Right 927436219 2:23068823-23068845 TCCTGTTGAAAGCACACCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927436218 Original CRISPR CAGGATAATAATACAGTTCT TGG (reversed) Intergenic
No off target data available for this crispr