ID: 927438395

View in Genome Browser
Species Human (GRCh38)
Location 2:23090152-23090174
Sequence GTGCCCAACCAGACTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927438395_927438400 19 Left 927438395 2:23090152-23090174 CCACCCTCAGTCTGGTTGGGCAC No data
Right 927438400 2:23090194-23090216 GTGACTAGAATAAAGCATACAGG No data
927438395_927438401 28 Left 927438395 2:23090152-23090174 CCACCCTCAGTCTGGTTGGGCAC No data
Right 927438401 2:23090203-23090225 ATAAAGCATACAGGAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927438395 Original CRISPR GTGCCCAACCAGACTGAGGG TGG (reversed) Intergenic
No off target data available for this crispr