ID: 927439664

View in Genome Browser
Species Human (GRCh38)
Location 2:23104369-23104391
Sequence GAACAATTCCAACCTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439664_927439666 -10 Left 927439664 2:23104369-23104391 CCTTTGTCAGGTTGGAATTGTTC No data
Right 927439666 2:23104382-23104404 GGAATTGTTCTGTGTTTAGGAGG No data
927439664_927439671 30 Left 927439664 2:23104369-23104391 CCTTTGTCAGGTTGGAATTGTTC No data
Right 927439671 2:23104422-23104444 CAGTTTGAACTGATGGTACGTGG No data
927439664_927439668 23 Left 927439664 2:23104369-23104391 CCTTTGTCAGGTTGGAATTGTTC No data
Right 927439668 2:23104415-23104437 TTCCCTTCAGTTTGAACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439664 Original CRISPR GAACAATTCCAACCTGACAA AGG (reversed) Intergenic
No off target data available for this crispr