ID: 927439667

View in Genome Browser
Species Human (GRCh38)
Location 2:23104405-23104427
Sequence AAACTGAAGGGAAAAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439667_927439673 12 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data
927439667_927439671 -6 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439671 2:23104422-23104444 CAGTTTGAACTGATGGTACGTGG No data
927439667_927439672 -1 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439672 2:23104427-23104449 TGAACTGATGGTACGTGGCCTGG No data
927439667_927439675 27 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439675 2:23104455-23104477 ATAATTGGTCTTCCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439667 Original CRISPR AAACTGAAGGGAAAAGATAC AGG (reversed) Intergenic
No off target data available for this crispr