ID: 927439669

View in Genome Browser
Species Human (GRCh38)
Location 2:23104417-23104439
Sequence TACCATCAGTTCAAACTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439669_927439673 0 Left 927439669 2:23104417-23104439 CCCTTCAGTTTGAACTGATGGTA No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data
927439669_927439675 15 Left 927439669 2:23104417-23104439 CCCTTCAGTTTGAACTGATGGTA No data
Right 927439675 2:23104455-23104477 ATAATTGGTCTTCCCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439669 Original CRISPR TACCATCAGTTCAAACTGAA GGG (reversed) Intergenic
No off target data available for this crispr