ID: 927439670

View in Genome Browser
Species Human (GRCh38)
Location 2:23104418-23104440
Sequence GTACCATCAGTTCAAACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439670_927439679 30 Left 927439670 2:23104418-23104440 CCTTCAGTTTGAACTGATGGTAC No data
Right 927439679 2:23104471-23104493 TCTTTGGTTTACAGCACAGATGG No data
927439670_927439675 14 Left 927439670 2:23104418-23104440 CCTTCAGTTTGAACTGATGGTAC No data
Right 927439675 2:23104455-23104477 ATAATTGGTCTTCCCCTCTTTGG No data
927439670_927439673 -1 Left 927439670 2:23104418-23104440 CCTTCAGTTTGAACTGATGGTAC No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439670 Original CRISPR GTACCATCAGTTCAAACTGA AGG (reversed) Intergenic
No off target data available for this crispr