ID: 927439671

View in Genome Browser
Species Human (GRCh38)
Location 2:23104422-23104444
Sequence CAGTTTGAACTGATGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439664_927439671 30 Left 927439664 2:23104369-23104391 CCTTTGTCAGGTTGGAATTGTTC No data
Right 927439671 2:23104422-23104444 CAGTTTGAACTGATGGTACGTGG No data
927439667_927439671 -6 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439671 2:23104422-23104444 CAGTTTGAACTGATGGTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439671 Original CRISPR CAGTTTGAACTGATGGTACG TGG Intergenic
No off target data available for this crispr