ID: 927439672

View in Genome Browser
Species Human (GRCh38)
Location 2:23104427-23104449
Sequence TGAACTGATGGTACGTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439667_927439672 -1 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439672 2:23104427-23104449 TGAACTGATGGTACGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439672 Original CRISPR TGAACTGATGGTACGTGGCC TGG Intergenic
No off target data available for this crispr