ID: 927439673

View in Genome Browser
Species Human (GRCh38)
Location 2:23104440-23104462
Sequence CGTGGCCTGGATTTGATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927439670_927439673 -1 Left 927439670 2:23104418-23104440 CCTTCAGTTTGAACTGATGGTAC No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data
927439669_927439673 0 Left 927439669 2:23104417-23104439 CCCTTCAGTTTGAACTGATGGTA No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data
927439667_927439673 12 Left 927439667 2:23104405-23104427 CCTGTATCTTTTCCCTTCAGTTT No data
Right 927439673 2:23104440-23104462 CGTGGCCTGGATTTGATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927439673 Original CRISPR CGTGGCCTGGATTTGATAAT TGG Intergenic
No off target data available for this crispr