ID: 927440479

View in Genome Browser
Species Human (GRCh38)
Location 2:23112675-23112697
Sequence TAAGAGTTCACAGACTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927440475_927440479 7 Left 927440475 2:23112645-23112667 CCAAGATGTAGGAAATACATTCT No data
Right 927440479 2:23112675-23112697 TAAGAGTTCACAGACTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927440479 Original CRISPR TAAGAGTTCACAGACTCCTT GGG Intergenic