ID: 927441209

View in Genome Browser
Species Human (GRCh38)
Location 2:23119341-23119363
Sequence CTGTCCACACAGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927441201_927441209 7 Left 927441201 2:23119311-23119333 CCCTTGAGCTAGAGGAAGAAGAA No data
Right 927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG No data
927441199_927441209 27 Left 927441199 2:23119291-23119313 CCTTTAAGAAAGTTTGCTGACCC No data
Right 927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG No data
927441202_927441209 6 Left 927441202 2:23119312-23119334 CCTTGAGCTAGAGGAAGAAGAAA No data
Right 927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG No data
927441198_927441209 28 Left 927441198 2:23119290-23119312 CCCTTTAAGAAAGTTTGCTGACC No data
Right 927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927441209 Original CRISPR CTGTCCACACAGATGGTGGA GGG Intergenic
No off target data available for this crispr