ID: 927443206

View in Genome Browser
Species Human (GRCh38)
Location 2:23134574-23134596
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927443202_927443206 8 Left 927443202 2:23134543-23134565 CCTTCATTCACAACTGGATCCCT No data
Right 927443206 2:23134574-23134596 CCAGTCCTGCAGATCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type