ID: 927444143

View in Genome Browser
Species Human (GRCh38)
Location 2:23142834-23142856
Sequence CACTATCTGAAAAGCTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927444143_927444146 24 Left 927444143 2:23142834-23142856 CCTCCCTAGCTTTTCAGATAGTG No data
Right 927444146 2:23142881-23142903 TCCTCCTTCTCCCAAGATAAAGG No data
927444143_927444148 25 Left 927444143 2:23142834-23142856 CCTCCCTAGCTTTTCAGATAGTG No data
Right 927444148 2:23142882-23142904 CCTCCTTCTCCCAAGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927444143 Original CRISPR CACTATCTGAAAAGCTAGGG AGG (reversed) Intergenic