ID: 927444144

View in Genome Browser
Species Human (GRCh38)
Location 2:23142837-23142859
Sequence AGACACTATCTGAAAAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927444144_927444146 21 Left 927444144 2:23142837-23142859 CCCTAGCTTTTCAGATAGTGTCT No data
Right 927444146 2:23142881-23142903 TCCTCCTTCTCCCAAGATAAAGG No data
927444144_927444148 22 Left 927444144 2:23142837-23142859 CCCTAGCTTTTCAGATAGTGTCT No data
Right 927444148 2:23142882-23142904 CCTCCTTCTCCCAAGATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927444144 Original CRISPR AGACACTATCTGAAAAGCTA GGG (reversed) Intergenic
No off target data available for this crispr