ID: 927444146

View in Genome Browser
Species Human (GRCh38)
Location 2:23142881-23142903
Sequence TCCTCCTTCTCCCAAGATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927444145_927444146 20 Left 927444145 2:23142838-23142860 CCTAGCTTTTCAGATAGTGTCTC No data
Right 927444146 2:23142881-23142903 TCCTCCTTCTCCCAAGATAAAGG No data
927444144_927444146 21 Left 927444144 2:23142837-23142859 CCCTAGCTTTTCAGATAGTGTCT No data
Right 927444146 2:23142881-23142903 TCCTCCTTCTCCCAAGATAAAGG No data
927444143_927444146 24 Left 927444143 2:23142834-23142856 CCTCCCTAGCTTTTCAGATAGTG No data
Right 927444146 2:23142881-23142903 TCCTCCTTCTCCCAAGATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927444146 Original CRISPR TCCTCCTTCTCCCAAGATAA AGG Intergenic