ID: 927445211

View in Genome Browser
Species Human (GRCh38)
Location 2:23154536-23154558
Sequence ACTGATCAGGAAATTAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927445211_927445214 -9 Left 927445211 2:23154536-23154558 CCAATGCTAATTTCCTGATCAGT No data
Right 927445214 2:23154550-23154572 CTGATCAGTGAGGTGTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927445211 Original CRISPR ACTGATCAGGAAATTAGCAT TGG (reversed) Intergenic
No off target data available for this crispr