ID: 927445632

View in Genome Browser
Species Human (GRCh38)
Location 2:23158689-23158711
Sequence TAACTGACCCTCAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927445629_927445632 12 Left 927445629 2:23158654-23158676 CCAGGAAACAAGGGGTGCAGTCT No data
Right 927445632 2:23158689-23158711 TAACTGACCCTCAGAGAAGGAGG No data
927445623_927445632 30 Left 927445623 2:23158636-23158658 CCTTGACAATCTCCAGTTCCAGG No data
Right 927445632 2:23158689-23158711 TAACTGACCCTCAGAGAAGGAGG No data
927445628_927445632 18 Left 927445628 2:23158648-23158670 CCAGTTCCAGGAAACAAGGGGTG No data
Right 927445632 2:23158689-23158711 TAACTGACCCTCAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927445632 Original CRISPR TAACTGACCCTCAGAGAAGG AGG Intergenic
No off target data available for this crispr