ID: 927446362

View in Genome Browser
Species Human (GRCh38)
Location 2:23165537-23165559
Sequence CGTGATAAGAAGCTGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927446357_927446362 15 Left 927446357 2:23165499-23165521 CCTGTGGACCATGGTGAGCGTGG No data
Right 927446362 2:23165537-23165559 CGTGATAAGAAGCTGTTGCAGGG No data
927446360_927446362 7 Left 927446360 2:23165507-23165529 CCATGGTGAGCGTGGTGGCTTCA No data
Right 927446362 2:23165537-23165559 CGTGATAAGAAGCTGTTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927446362 Original CRISPR CGTGATAAGAAGCTGTTGCA GGG Intergenic
No off target data available for this crispr