ID: 927447969

View in Genome Browser
Species Human (GRCh38)
Location 2:23182274-23182296
Sequence AGACAAATCCACAATTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927447966_927447969 23 Left 927447966 2:23182228-23182250 CCTCAAAATACACTAGGCACAAA No data
Right 927447969 2:23182274-23182296 AGACAAATCCACAATTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927447969 Original CRISPR AGACAAATCCACAATTATAT TGG Intergenic
No off target data available for this crispr