ID: 927448329

View in Genome Browser
Species Human (GRCh38)
Location 2:23185317-23185339
Sequence GCTTGTCTGGCACAGGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927448329_927448335 -3 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448335 2:23185337-23185359 AGCTAAATCAGTATTACCTAGGG No data
927448329_927448334 -4 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448334 2:23185336-23185358 AAGCTAAATCAGTATTACCTAGG No data
927448329_927448339 7 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448339 2:23185347-23185369 GTATTACCTAGGGAGGGGAGCGG No data
927448329_927448342 14 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448342 2:23185354-23185376 CTAGGGAGGGGAGCGGGAATTGG No data
927448329_927448336 0 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data
927448329_927448337 1 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448337 2:23185341-23185363 AAATCAGTATTACCTAGGGAGGG No data
927448329_927448340 8 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448340 2:23185348-23185370 TATTACCTAGGGAGGGGAGCGGG No data
927448329_927448338 2 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927448329 Original CRISPR GCTTGTCTGGCACAGGGCCT GGG (reversed) Intergenic