ID: 927448330

View in Genome Browser
Species Human (GRCh38)
Location 2:23185318-23185340
Sequence AGCTTGTCTGGCACAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927448330_927448335 -4 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448335 2:23185337-23185359 AGCTAAATCAGTATTACCTAGGG No data
927448330_927448342 13 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448342 2:23185354-23185376 CTAGGGAGGGGAGCGGGAATTGG No data
927448330_927448337 0 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448337 2:23185341-23185363 AAATCAGTATTACCTAGGGAGGG No data
927448330_927448340 7 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448340 2:23185348-23185370 TATTACCTAGGGAGGGGAGCGGG No data
927448330_927448334 -5 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448334 2:23185336-23185358 AAGCTAAATCAGTATTACCTAGG No data
927448330_927448336 -1 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data
927448330_927448338 1 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448338 2:23185342-23185364 AATCAGTATTACCTAGGGAGGGG No data
927448330_927448339 6 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448339 2:23185347-23185369 GTATTACCTAGGGAGGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927448330 Original CRISPR AGCTTGTCTGGCACAGGGCC TGG (reversed) Intergenic