ID: 927448334

View in Genome Browser
Species Human (GRCh38)
Location 2:23185336-23185358
Sequence AAGCTAAATCAGTATTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927448330_927448334 -5 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448334 2:23185336-23185358 AAGCTAAATCAGTATTACCTAGG No data
927448329_927448334 -4 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448334 2:23185336-23185358 AAGCTAAATCAGTATTACCTAGG No data
927448331_927448334 -10 Left 927448331 2:23185323-23185345 CCCTGTGCCAGACAAGCTAAATC No data
Right 927448334 2:23185336-23185358 AAGCTAAATCAGTATTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927448334 Original CRISPR AAGCTAAATCAGTATTACCT AGG Intergenic