ID: 927448336

View in Genome Browser
Species Human (GRCh38)
Location 2:23185340-23185362
Sequence TAAATCAGTATTACCTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
927448329_927448336 0 Left 927448329 2:23185317-23185339 CCCAGGCCCTGTGCCAGACAAGC No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data
927448330_927448336 -1 Left 927448330 2:23185318-23185340 CCAGGCCCTGTGCCAGACAAGCT No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data
927448331_927448336 -6 Left 927448331 2:23185323-23185345 CCCTGTGCCAGACAAGCTAAATC No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data
927448332_927448336 -7 Left 927448332 2:23185324-23185346 CCTGTGCCAGACAAGCTAAATCA No data
Right 927448336 2:23185340-23185362 TAAATCAGTATTACCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
927448336 Original CRISPR TAAATCAGTATTACCTAGGG AGG Intergenic